Labshake search
Citations for Takara Bio :
101 - 150 of 5282 citations for Human Histone H3.3C H3 5 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: The cDNA encoding human BORCS6 was cloned from human lung total RNA (Takara Bio, Japan) and inserted into pCR4-TOPO (Invitrogen ...
-
bioRxiv - Cell Biology 2023Quote: Human MPS1 and NSL1 were amplified from Human testis cDNA (Marathon cDNA; Takara Bio Inc.) using Pfu polymerase (Promega) ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... mtDNA copy number was determined by quantitative PCR with Human mitochondrial to nuclear DNA ratio kit (Takara Bio USA, 7246).
-
bioRxiv - Immunology 2023Quote: ... cDNA libraries were generated using SMARTer Human TCR a/b Profiling Kit v2 (Takara Bio USA, San Jose, California, USA). Briefly ...
-
bioRxiv - Cell Biology 2024Quote: A PCR product containing the Human ORF for DDX3X was obtained directly from RNA using the Primescript High Fidelity RT-PCR kit from Takara. The PCR primers introduced BamHI and NotI sites at the 5’ and 3’ ends respectively ...
-
bioRxiv - Developmental Biology 2022Quote: ... 5’ and 3’ RACE ready cDNA was generated from a pooled female pupal RNA sample and also from a pooled adult female ovary sample (RNA extracted using RNeasy MinElute kit, RACE conducted using SMARTer 5⍰/3⍰ RACE kit - Takara Bio, Kyoto, Japan). Visible bands were cloned using the NEB PCR cloning kit (New England Biolabs ...
-
bioRxiv - Molecular Biology 2020Quote: ... containing the beta-globin (HBB) 5’-UTR using the In-Fusion® HD Cloning Kit (Takara). The subsequent mutations in the TCRA and TCRB 3’-UTRs were generated using these initial constructs ...
-
bioRxiv - Immunology 2019Quote: ... 5’ RACE first-strand cDNA synthesis was conducted using the SMARTer RACE cDNA Amplification Kit (Takara Bio ...
-
bioRxiv - Immunology 2019Quote: ... RACE-ready cDNA synthesis was performed using the SMARTer RACE 5’/3’ Kit (Takara Bio USA) using primers with specificity to IgM ...
-
bioRxiv - Cell Biology 2023Quote: ... and 5 µg RNA was reverse transcribed into cDNA using a cDNA synthesis kit (Takara Bio) as per the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2023Quote: ... 1 μg total RNA was reverse transcribed into cDNA with the SMARTer RACE 5’ Kit (Clontech). PCR was performed using primer GSP-HO1 and the Universal Primer Mix (UPM ...
-
bioRxiv - Immunology 2024Quote: ... The TCR sequences were then isolated using 5’RACE (SMARTer RACE cDNA Amplification Kit, Takara Bio), followed by PCR amplification with primers designed to be complementary to TRAC (GTTGCTCCAGGCAATGGCCCCATTGCTC ...
-
bioRxiv - Microbiology 2021Quote: ... An anti-histidine antibody was used for ELISAs as positive control (Takara, catalog # 631212).
-
bioRxiv - Neuroscience 2019Quote: ... and human WT hP-NPO cDNA was amplified from human brain cDNA library (TaKaRa, Cat #637242) with primers ...
-
bioRxiv - Cell Biology 2021Quote: ... The nucleotide sequence encoding for human CyPD was obtained from a Human cDNA placenta library (Clontech) by PCR ...
-
bioRxiv - Cell Biology 2020Quote: ... with the following primers (forward 5’ GAATTCAGATCTATGGTGAGCAAGGGCGAG and reverse 5’ gaattcagatctcttgtacagctcgtccatg) or (forward 5’ GAATTCAGATCTATGGTGAGCAAGGGCGAGGAG and reverse 5’ gaattcagatctcttgtacagctcgtccatgccg) using pEGFP (Clontech) or pCMV-mCherry2 (Clontech ...
-
bioRxiv - Microbiology 2020Quote: Human embryonic kidney 293T (Clontech, 632180), human lung carcinoma A549 (ATCC ...
-
bioRxiv - Cell Biology 2021Quote: Plasmids for the pull-down assay were constructed by cloning human Kif7 and Gli2 sequences into pCMV-BICEP™-4 expression vector followed by truncations using InFusion HD Cloning Kit (Takara). Kif7 fragments were cloned at the MCS1 to express FLAG-tagged Kif7 protein and Gli2 fragments were cloned at the MCS2 to express c-myc-tagged Gli2 protein ...
-
bioRxiv - Molecular Biology 2020Quote: ... Illumina data from human HEK293T cells were processed with the SMARTer® smRNA-Seq Kit for Illumina (Takara, Cat. Nos. 635029) following guidelines ...
-
bioRxiv - Bioengineering 2021Quote: ... Human umbilical vein endothelial cells (HUVECs) and human aortic smooth muscle cells (HAoSMCs) were purchased from TAKARA BIO (Tokyo ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... with 0.1 µL of Taq Polymerase 5 U.µL-1 (TaKaRa Ex Taq® Kit MgCl2 Free Buffer) (TaKaRa Ex Taq ...
-
bioRxiv - Cell Biology 2023Quote: ... pseudonana (PtPyShell1, TpPyShell1, and TpPyShell2) were determined by RACE using a SMARTer RACE 5’/3’ kit (TaKaRa). Sequences were amplified by PCR and cloned into pPha-T1 or pTha-NR vectors containing a fragment of enhanced GFP by a seamless ligation cloning extract method (Motohashi ...
-
bioRxiv - Molecular Biology 2024Quote: ... or 5 ng of total RNA (with a SMARTer Stranded Total RNA-Seq Kit v3; Takara Bio) was used.
-
bioRxiv - Biochemistry 2019Quote: ... and a H2A histone lacking the C-terminal residues 110-130 were cloned using In-Fusion® HD cloning strategy (Takara Bio).
-
bioRxiv - Neuroscience 2020Quote: ... 341F (5’-CCTACGGGNGGCWGCAG-3’) and 805R (5’-GACTACHVGGGTATCTAATCC-3’) or (2) 341F (5’-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCTACGGGNGGCWGCAG-3’) and 806R (5’-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGGACTACHVGGGTWTCTAAT-3’) (TaKaRa Bio, Shiga, Japan). The second PCR was performed to add the index sequences for Illumina sequencing with barcode sequences ...
-
bioRxiv - Neuroscience 2019Quote: ... test genes (vascular connexins) in human vessels were normalized relative to human whole heart (RNA purchased from Clontech) and in mouse ...
-
bioRxiv - Neuroscience 2020Quote: ... cDNA of Human Phosphodiesterase type 10 (hPDE10) was amplified by conventional nested PCR using human brain cDNA (Clontech). cDNAs template encoding wild-type and D674A mutant form of hPDE10 catalytic domain (CD ...
-
bioRxiv - Developmental Biology 2024Quote: ... Human full-coding KATNA1 cDNA was isolated from a human fetal brain Marathon-ready cDNA collection (Clontech, Invitrogen) with the following forward and reverse primers ...
-
bioRxiv - Immunology 2022Quote: Matched healthy donor RNA was used to generate targeted IgG and IgM AIRR-seq libraries using the SMARTer Human BCR IgG IgM H/K/L Profiling Kit (Takara Bio USA) according to the manufacturer’s instructions with no modifications ...
-
bioRxiv - Neuroscience 2021Quote: Human Brain Total RNA (Takara Cat. #636530) and Human Brain Cerebral Cortex Total RNA (Takara Cat ...
-
bioRxiv - Microbiology 2019Quote: Human fetal NSCs were purchased from Clontech (human neural cortex ...
-
bioRxiv - Bioengineering 2021Quote: Human embryonic kidney (HEK293T) cells (632180; Takara) were cultured in DMEM (10-013-CV ...
-
bioRxiv - Cell Biology 2022Quote: ... Human embryonic kidney epithelial Lenti-X293T (Clontech) cells were cultured in complete DMEM (Sigma Aldrich ...
-
Replication Timing and Transcription Identifies a Novel Fragility Signature Under Replication StressbioRxiv - Genetics 2019Quote: Human foreskin fibroblasts BJ-hTERT cells (Clontech) were grown in DMEM supplemented with 10% fetal bovine serum ...
-
bioRxiv - Cell Biology 2020Quote: ... Human Universal QUICK-Clone cDNA II (Clontech) for a template cDNA ...
-
bioRxiv - Cell Biology 2023Quote: Human cardiomyocyte cells were purchased from Takara Bio (ref Y10060) ...
-
bioRxiv - Microbiology 2020Quote: ... cDNA was generated following the SMARTer® 5’/3’ RACE kit protocol (Takara Bio, Kusatsu, Shiga Prefecture, Japan).
-
bioRxiv - Biophysics 2022Quote: ... 3’-RACE-Ready cDNA template was synthesized using a SMARTer® RACE 5’/3’ Kit (Takara Bio, USA) and subsequently used to amplify 3’ end sequences of R ...
-
bioRxiv - Immunology 2022Quote: ... IGK and IGL 5’RACE AIRR-seq libraries were generated using the SMARTer Mouse BCR Profiling Kit (Takara Bio ...
-
bioRxiv - Developmental Biology 2022Quote: Rapid amplification of cDNA end (RACE) was performed using the SMARTer® RACE 5’/3’ Kit (Takara, #634858). 1ug of freshly isolated RNA from E8.5 embryo hearts was used to generate first strand cDNA according to the manufactural protocol ...
-
bioRxiv - Cell Biology 2023Quote: ... and used for library preparation (5-10 ng) using SMART-Seq v4 Ultra Low Input RNA Kit (Clontech). Libraries were sequenced on Novaseq platform (Illumina).
-
bioRxiv - Molecular Biology 2023Quote: ... The 5’ and 3’ ends of the cDNA were amplified using the SMARTer RACE cDNA Amplification Kit (Clontech) according to the manufacturer’s guidelines ...
-
bioRxiv - Cell Biology 2023Quote: The full-length cDNA expression library was constructed using the SMARTer RACE 5’/3’ Kit (Takara Bio, 634858) according to the manufacturer’s instructions for the In-Fusion SMARTer Directional cDNA Library Construction Kit (Takara Bio ...
-
bioRxiv - Cell Biology 2023Quote: We used an hESC line that transiently expresses the C-terminal region (catalytic domain) of histone demethylase JMJD3 in a doxycycline (DOX, Takara Bio Inc, Japan) inducible manner (12 ...
-
bioRxiv - Neuroscience 2024Quote: ... was purchased from Clontech (Clontech; #P3070-5). Plasmids were prepared using the ZymoPURE Plasmid MaxiPrep Kit (Zymo Research ...
-
bioRxiv - Biophysics 2019Quote: A cDNA encoding human DBNL was amplified by PCR from Human Brain Whole QUICK-Clone™ cDNA (Clontech Laboratories) using the primers ...
-
bioRxiv - Genomics 2021Quote: U2OS (human bone osteosarcoma epithelial, female, ATCC HTB-96) and LentiX 293T (human embroyonic kidney epithelial, female, Takara 632180) cells were cultured in Dulbecco’s modified Eagle medium (DMEM ...
-
bioRxiv - Cell Biology 2023Quote: A cDNA fragment encoding human FAM53C was isolated by amplifying with nested PCR from human cDNA library plasmid (Takara). The oligonucleotide primer sequences used for the 1st PCR are 5′-CAAAGTGTGCAAGTCAAATCCTGG-3′ (5′ upstream ...
-
bioRxiv - Immunology 2021Quote: ... T cell receptor sequencing libraries were prepared with the SMARTer Human TCR α/β Profiling Kit (catalog number 635015, Takara Bio USA, Inc.) according to manufacturer’s instructions with the exception of excluding the third and fourth bead size selection steps listed in Table 3 of the kit manual ...
-
bioRxiv - Genomics 2020Quote: The amplified library was then recombined with pCMV FAS wt minigene exon 5-6-7 (Förch et al., 2000) using the In-Fusion HD Cloning kit (639649, Clontech) in a 1:8 vector:insert optimized ratio and transformed into Stellar competent cells (636766 ...