Labshake search
Citations for Takara Bio :
1 - 50 of 5282 citations for Human Histone H3.3C H3 5 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: Lenti-X™ p24 Rapid Titration ELISA Kit (TaKaRa) was used to determine virus titer ...
-
bioRxiv - Biochemistry 2024Quote: ... The sequence of human histone H2A(K15C-129) was cloned into the pCold-Trigger factor (TF) vector (Takara Bio) with a SUMO coding sequence inserted to generate His6–TF–SUMO–H2A(K15C-129 ...
-
bioRxiv - Cancer Biology 2020Quote: ... The titer of virus was measured using P24 ELISA kit (Clontech).The virus was aliquoted and stored at −80°C.
-
bioRxiv - Genomics 2022Quote: ... IgG and IgM 5’RACE AIRR-seq libraries were generated using the SMARTer Human BCR Profiling Kit (Takara Bio), following the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2020Quote: ... viral titer was determined using the lentiviral p24 ELISA kit from Takara Bio (MountainView ...
-
bioRxiv - Molecular Biology 2024Quote: ... and the human herpes simplex virus 5 puromycin resistance marker (Clontech).
-
bioRxiv - Cell Biology 2022Quote: ... Lentiviral titers were determined using the LentiX-p24 Rapid Titer ELISA kit (Takara). All cell culture reagents were obtained from ThermoFisher Scientific ...
-
bioRxiv - Cancer Biology 2023Quote: ... Concentrated viruses were titered using the p24-Elisa kit (Takara Bio, cat. 632200) following manufacturer’s protocols ...
-
bioRxiv - Systems Biology 2020Quote: Human mitochondrial to nuclear DNA ratio kit (Takara) was used to assess mitochondrial DNA content ...
-
bioRxiv - Immunology 2022Quote: ... 25 μg of the retroviral expression vector (pLZRS-human codon-optimized Bcl6-P2A-human codon-optimized BclxL-IRES-GFP) and 5 μg of the envelope vector (p10A1; Clontech) were transfected into GP2-293 cells using Lipofectamine 3000 (ThermoFisher ...
-
bioRxiv - Bioengineering 2020Quote: ... and 21 were measured with an enzyme immunosorbent assay (ELISA) kit (Takara, Shiga, Japan).
-
bioRxiv - Neuroscience 2020Quote: ... which were determined by an ELISA Adeno-X Rapid Titer Kit (Cat#: 631028, Takara). It detects the Adenoviral Hexon surface antigen ...
-
bioRxiv - Physiology 2022Quote: ... 5’-RACE was performed by SMARTer RACE 5’/3’ kit (Clontech) by manufacture protocol ...
-
bioRxiv - Cell Biology 2022Quote: ... 5’ RACE was performed using the SMARTer 5’/3’ kit (TAKARA) with slight modifications ...
-
bioRxiv - Cancer Biology 2023Quote: ... The virus titer was determined with Lenti-X™ p24 Rapid Titration ELISA Kit (Takara), according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... linearized chimeric H3 HA sequence was gel purified using the NucleoSpin Gel and PCR Clean-up kit (Takara, Cat. No. 740609.5) and then purified using Ampure XP beads (Beckman Coulter ...
-
bioRxiv - Molecular Biology 2022Quote: 5’ RACE was performed using SMARTer RACE 5’/3’ Kit (TAKARA #634858) following the manufacturer’s instructions ...
-
bioRxiv - Immunology 2022Quote: ... the SMARTer RACE 5’/3’ Kit (Takara) was used following manufacturer’s protocol and using the following primer ...
-
bioRxiv - Microbiology 2021Quote: ... a SMARTer RACE 5’/3’kit (Takara) was used ...
-
bioRxiv - Developmental Biology 2023Quote: SMARTer RACE 5’/3’ Kit from Takara Bio was used following the manufacturer’s instructions ...
-
bioRxiv - Immunology 2022Quote: 5’ and 3’ RACE was performed with SMARTer RACE 5’/3’ Kit (Takara) following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2020Quote: ... 5′ RACE was performed using the SMARTer RACE 5/3 kit (Takara Bio) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... Viral titer was determined by the ELISA p24 antigen assay (Lenti-X p24 Rapid Titer Kit, TaKaRa). Monocytes were infected immediately after purification by adding HIV-1BaL virus to the culture at MOI between 3 and 5 based on the p24 titer ...
-
bioRxiv - Microbiology 2022Quote: ... Viral titer was determined by the ELISA p24 antigen assay (Lenti-X p24 Rapid Titer Kit, TaKaRa). Infections of fully differentiated MDM were performed after adherent growth in the presence of M-CSF for seven days ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5’ RACE cDNA library was prepared using Clontech SMARTer RACE 5’/3’ Kit (Takara) according to the user manual with the gene-specific primer (S4 Table ...
-
bioRxiv - Bioengineering 2021Quote: ... The virus titre was calculated using the ELISA-based Lenti-X™ p24 Rapid Titer Kit (Takara Bio) following the manufacturer’s instructions.
-
bioRxiv - Plant Biology 2019Quote: Rapid amplification of 5’ cDNA ends (5’RACE) of CREF3 transcripts was performed using SMARTer RACE 5’/3’ Kit (Clontech) according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2021Quote: ... benthamiana plants was used for 5’ RACE with SMARTer RACE 5’/3’ Kit (Takara, Japan) according to the manual booklet.
-
bioRxiv - Microbiology 2022Quote: ... the 5′-terminus of the viral genome was determined by 5′/3′ RACE kits (TaKaRa). The resulting whole genome sequence of the GX_P2V variant was deposited in GenBank (accession number MW532698) ...
-
bioRxiv - Genetics 2022Quote: The 5’end of the cloned fragment was amplified with a 5’RACE kit (Takara). The 5’RACE adaptor in the kit was used to evaluate the mRNA ...
-
bioRxiv - Biophysics 2024Quote: Lentivirus titration was determined by p24 ELISA using Lenti-X™ p24 Rapid Titer Kit (Takara Bio, no. 632200) and a plate reader (PerkinElmer Victor3 V) ...
-
bioRxiv - Microbiology 2019Quote: ... and 5’- or 3’-RACE was performed with SMARTer®RACE 5’/3’ Kit (Takara, 634858) following the manufacturer’s instructions ...
-
bioRxiv - Immunology 2019Quote: The 5’ and 3’ RACE analyses were performed using the SMARTer RACE 5’/3’ Kit (Clontech) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2024Quote: 5’ RACE of lncRNA VILMIR was performed using the SMARTer RACE 5’/3’ Kit (Takara, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... 1995 (named L1 and H3) and TaKaRa LA Taq HS (Takara Bio Inc., Japan), followed by agarose gel electrophoresis (61).
-
bioRxiv - Microbiology 2024Quote: The SMARTer® RACE 5’/3’ kit (Takara Bio, USA) was used to generate cDNA according to the manufacturer’s instructions using a maPgV-specific reverse primer (TGCGAGAGCCGTCAGCCACA) ...
-
bioRxiv - Microbiology 2023Quote: ... 5’RACE was performed with SMARTer RACE 5’/3’ Kit (Takara Bio USA, Inc. San Jose, CA USA) according to the manufacturer’s directions.
-
bioRxiv - Systems Biology 2023Quote: ... before library preparation using the SMARTer Human TCR α/β Profiling Kit (Takara Bio). In brief ...
-
bioRxiv - Molecular Biology 2021Quote: ... we performed ELISA against HIV p24 (TaKaRa Clontech #632200) according to manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2021Quote: ... we performed ELISA against HIV p24 (TaKaRa Clontech #632200) according to manufacturer’s instructions ...
-
bioRxiv - Genomics 2024Quote: ... and titer quantified using p24 ELISA antigen assay (Takara). MOI=5 was used to transduce 1x1097 EndoC-βH3 cells in culture media without pen/strep and puromycin.
-
bioRxiv - Molecular Biology 2020Quote: RACE assay was performed with SMARTer RACE 5’/3’ kit (Clontech) according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2020Quote: The assay was performed using the 5’-Full RACE kit (TaKaRa) according to the manufacturer’s instructions with modifications ...
-
bioRxiv - Immunology 2021Quote: ... 5’ RACE was performed with SMARTer RACE cDNA Amplification Kit (Clontech). IgG /IgK/IgL NGS libraries were made by using NEBNext Ultra DNA Library Prep Kit for Illumina (NEB) ...
-
bioRxiv - Neuroscience 2021Quote: ... The SMARTer® RACE 5’/3’ Kit was purchased from Clontech Laboratories ...
-
bioRxiv - Microbiology 2020Quote: ... and 5 µL of the ligation mix (Takara Ligation Kit 6023), and then placing the tubes into a heat block at 90 °C for 15 min ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... SMARTer® RACE 5’/3’ Kit was used (Takara Bio, Japan). Prior to the reaction ...
-
bioRxiv - Evolutionary Biology 2021Quote: The 5’ and 3’ ends of Cpun_dsx were amplified using the SMARTer RACE 5’/3’kit (TaKaRa, Shiga, Japan) and gene-specific primers designed for OD2 (“Cpun_dsx OD2 5’RACE” and “Cpun_dsx OD2 3’RACE” ...
-
bioRxiv - Microbiology 2022Quote: Sequence of the human variable heavy and kappa chains were obtained by using SMARTer 5’ RACE technology (Takara Bio USA) adapted for antibodies to amplify the variable genes from heavy and kappa chains for each hybridoma ...
-
bioRxiv - Cancer Biology 2023Quote: ... mRNA was utilized with the SMARTer Human TCR a/b Profiling Kit v2 (Takara, USA). The resulting libraries were sequenced for paired-end reads of 2×250 bp on an Illumina system at a sequencing depth of 7.5X.