Labshake search
Citations for Takara Bio :
101 - 150 of 2173 citations for 8 4 ethoxy 3 methoxyphenyl 1 5 diazabicyclo 3.2.1 octane since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2020Quote: ... The cDNA synthesis was carried out by using 5 g of total RNA or 1 g of PAPed RNA with RT primer (5-TTTTTTTTUUUTTTTTVN-3) by PrimeScript II Reverse Transcriptase (TaKaRa Bio). The full-length cDNAs were selected by Cap Trapper method 60 ...
-
Potential for virus endogenization in humans through testicular germ cell infection: the case of HIVbioRxiv - Microbiology 2020Quote: ... VSV G-pseudotyped HIV-1 using full-length HIV-1 molecular clone pNL4-3 [79] or the R5-tropic pNL4-3 AD8 derivative [80] and VSV-G envelope encoding plasmid (PT3343-5, Clontech); 4 ...
-
bioRxiv - Molecular Biology 2020Quote: ... The FOXR1 wild-type and M280L mutant were then PCR amplified using forward 5′-AAAGCACTCGAGATGGGGAACGAGCTCTTTCTG-3’andreverse5’-TTTGGCCCGCGGTTAAAGATCAAAGAGGAAGGG-3’ primers and subcloned into the XhoI and SacII restriction sites of pEGFP-C3 (Clontech) to create an N-terminal EGFP tag ...
-
bioRxiv - Cell Biology 2020Quote: ... with 5’-cgGAATTCaccATGgagcagaagctc atctcagaagaagacctcggtAAGGATAACACCGTGCC-3’ and 5’-ataagaatGCGGCCGCtaaact ATTATTTTTCTGCACTACGCAGG-3’ followed by cloning into the EcoRI and Not I sites of pIRESpuro3 (Clontech) creating pIRESpuro3-myc-BirA ...
-
bioRxiv - Molecular Biology 2023Quote: ... the 3’ UTR of the virus were determined using the SMARTer®RACE 5’/3’ Kit (Takara Bio, Kusatsu, Japan). 2.4 µg of RGMoV gRNA was polyadenylated using Poly(A)polymerase (600 u/µl ...
-
bioRxiv - Plant Biology 2020Quote: ... according to the manufacturer’s instructions (SMARTer® RACE 5’/3’ Kit, Clontech, USA), with gene specific primers (YFT1-GSP5′-R/GSP3′-F ...
-
bioRxiv - Cell Biology 2021Quote: ... and 5’- GAGCTCTAGGATATCGAATTCTCGAGTCACTTGCACAGGGCCTCCAACACC-3’ and inserted into the pLVSIN vector (Takara Bio, Japan) by HiFi assembly (New England Biolabs ...
-
bioRxiv - Developmental Biology 2022Quote: ... For RACE analysis we used the SMARTer® RACE 5’/3’ Kit (Takara) according to manufacturer’s recommendations (see Supplementary Table 8 for the list of primers used).
-
bioRxiv - Neuroscience 2023Quote: ... and CaMKK2 (5’-CCCTTTCATGGATGAACGAAT-3’) were cloned into pBAsi-hH1 vector (Takara, 3220). pCAG-AMPKα1(WT ...
-
bioRxiv - Microbiology 2023Quote: ... The RACE experiment was carried out using SMARTer RACE 5’/3’ Kit (Clontech) according to the manufacturer’s instructions.
-
bioRxiv - Microbiology 2023Quote: ... cDNA was synthesized using SMARTer RACE 5’/3’ Kit (Takara Bio, Shiga, Japan). ssRNA was converted into cDNA using SMARTer Universal Low Input RNA Kit according to the manufacturer’s protocol (Takara Bio) ...
-
bioRxiv - Physiology 2023Quote: 5’ and 3’ RACE assays were performed using a SMARTer RACE kit (Clontech) according to the manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... the membrane was incubated overnight at 4°C with an anti-GFP monoclonal primary (JL-8; Clontech 632381) at 1:5,000 dilution ...
-
bioRxiv - Microbiology 2019Quote: ... (5’-GGT CTC TCT GGT TAG ACC AGA TCT GAG C-3’ and 5’-AAA CAT GGG TAT TAC TTC TGG GCT GAA AG-3’) using PrimeSTAR®HS (TAKARA) and purified by QIAquick Gel Extraction (QIAGEN) ...
-
Dynamic states of eIF6 and SDS variants modulate interactions with uL14 of the 60S ribosomal subunitbioRxiv - Biochemistry 2022Quote: ... pRSFDUET-1-EIF6 plasmid was co-transformed with pG-KJE8 expressing five bacterial chaperones (5-Ch: DnaK-DnaJ-GrpE, GroES, GroEL) or pG-TF2 expressing 3 bacterial chaperones (3-Ch: GroES, GroEL, TF) (Takara Biosciences) in BL21 (DE3 ...
-
bioRxiv - Immunology 2019Quote: ... Following the generation of cDNA using 5’RACE (rapid amplification of cDNA-ends; SMARTer RACE 5’/3’ Kit; Takara/Clontech), PCR amplification was performed using a Q5 polymerase (NEB ...
-
bioRxiv - Immunology 2019Quote: ... Following the generation of cDNA using 5’RACE (rapid amplification of cDNA-ends; SMARTer RACE 5’/3’ Kit; Takara/Clontech), PCR amplification was performed using a Q5 polymerase (NEB ...
-
bioRxiv - Microbiology 2019Quote: ... A 500 ng of the RNA was used for the 5’RACE reaction with SMARTer RACE 5’/3’ kit (Clontech), according to manufacture’s instruction ...
-
bioRxiv - Molecular Biology 2023Quote: ... synthesized 5’ and 3’ fragments of the target RNA were 32P-radiolabeled at the 5’ end using T4 polynucleotide kinase (Takara). After gel purification ...
-
bioRxiv - Bioengineering 2021Quote: ... 1/3 volume Retro-X concentrator (Takara) was added ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 3 μM Shield-1 (Takara Bio) for indicated times ...
-
bioRxiv - Developmental Biology 2019Quote: ... 3×Flag-Adnp or HA-Ctnnb1 were subcloned into pTRE3G or pLVX-tight-puro expression vector (Clontech, PT5167-1 and PT3996-5) using In-fusion HD cloning system (Clontech ...
-
bioRxiv - Biophysics 2024Quote: ... The supernatant was then diluted 1:5 to improve binding efficiency and incubated overnight on the rotisserie at 4°C with TALON Cobalt Resin (Takara Bio). The next day the resin was washed with 10 column volumes of Membrane Buffer 1 ...
-
bioRxiv - Microbiology 2021Quote: ... Primers used for amplifying insert (5’- CACAGAGAACAGATTGGTGGATCCATGGTAGATATAAACAACAATAAGATTAG-3’ and 5’-GTGGTGGTGGTGGTGTAACTCGAGGAGATAACCTTGTACATCATCTGTAT GC-3’) contained 15-bp overhang with homology to the plasmid for InFusion cloning (Takara Bio, 638947). The resulting plasmid ...
-
bioRxiv - Neuroscience 2023Quote: ... with primers 5’-TCTTCCACTAGTGCCACCATGGCCACAGCTTGTAAAAGATC-3’ and 5’-TCTTCCGGATCCTTACAGCATGCCAAATCCTTTGG-3’ and subcloning into the SpeI and BamHI sites of the pLVX-IRES-mCherry vector (Clontech Cat#631237). HEK293T cells were transfected in 96-well using Lipofectamine 3000 Reagent (ThermoFisher ...
-
bioRxiv - Microbiology 2020Quote: ... The 5’ RACE reaction was performed with an ac13-specific primer (ac13-GSP1) using a SMARTer® RACE 5’/3’ Kit (TaKaRa) according to the manufacturer’s protocol ...
-
bioRxiv - Evolutionary Biology 2023Quote: Complete cDNA sequences of taste receptors were obtained using a SMARTer 5’/3’ kit for RACE PCR to obtain 5’ sequence information missing from reference transcriptome (Takara, #634858). Briefly ...
-
bioRxiv - Microbiology 2021Quote: ... we performed RACE PCR using a SMARTer® RACE 5’/3’ Kit (Takara Bio), according to the manufacturer’s specifications ...
-
bioRxiv - Genetics 2020Quote: ... A 3′-dephosphorylation and 5′-phosphorylation reaction was performed using T4 PNK enzyme (TaKaRa). The enzyme was removed by phenol-chloroform purification ...
-
bioRxiv - Cell Biology 2024Quote: ... anti-GFP (JL-8, 1:3000, Clontech, Saint-Germain-en-Laye, France) and anti-Actin (AC74 ...
-
bioRxiv - Microbiology 2019Quote: ... flanked by a 5’ terminal Kozak sequence and 3’ terminal stop codon into the Nhe1 and Sal1 sites of pIRES2-EGFP (Clontech cat # 6029-1).
-
bioRxiv - Synthetic Biology 2022Quote: Retroviral/lentiviral transductions were performed on days 3 and 4 post activation on retronectin (Takara) coated non-tissue culture treated plates ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... we made a master mix using the primers 2550F = 5’-GTT ACT GAT TCG TCT ACG AGA-3’ and 2718R = 5’-ATT GAA ATG ATC CAG TGC TTG-3’ and TaKaRa ExTaq DNA Polymerase (Takara Bio USA, Inc). We ran the samples for 31 cycles and ran the PCR product on a 2% agarose gel.
-
bioRxiv - Molecular Biology 2019Quote: ... Same volume of samples were loaded on 4-16% gradient SDS-PAGE gels and analyzed by western blot analysis using EGFP (JL-8; Clontech), penta-HIS (QIAGEN ...
-
bioRxiv - Physiology 2019Quote: ... Membranes were incubated at 4°C in primary antibodies diluted 1:1000 in 5% bovine serum albumin: anti-GFP (ClonTech Living Colours #ab632375), anti-HSP60 (Department of Biology ...
-
bioRxiv - Microbiology 2020Quote: ... single-stranded (ss) cDNA (sscDNA) was synthesized using the SMARTer RACE 5′/3′ Kit (Takara) with a U2-complementary primer ...
-
bioRxiv - Microbiology 2020Quote: ... The terminal sequences were recovered using a SMARTer® RACE 5’/3’ Kit (Takara, Japan) according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2023Quote: Rapid amplification of cDNA ends was performed using the SMARTerR RACE 5’/3’kit (Takara), us 1 μg of DNA-free RNA from zeocin-treated samples as template for first-strand cDNA synthesis according to manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2023Quote: 3’ and 5’RACE reactions were carried out using the SMARTer 3’5’ RACE kit (Takara), essentially as recommended by the manufacturer ...
-
bioRxiv - Microbiology 2020Quote: ... Immunoblots were probed with mouse anti-GFP (1:10,000 JL-8, Clontech #632380) and rabbit anti-β-actin (1:10,000 Cell Signaling #4967 ...
-
bioRxiv - Plant Biology 2021Quote: Transcription start sites were characterised by cloning and sequencing 5’ RACE products using the SMARTer RACE 5’/3’ kit (Takara Bio USA, Inc). In summary ...
-
bioRxiv - Biochemistry 2023Quote: ... GFP (JL-8, Clontech) or Vinculin (7F9 ...
-
bioRxiv - Neuroscience 2020Quote: ... cDNA was pre-amplified by adding 2 uL of cDNA from each sample to 8 uL of preamp master mix [5 uL TaKaRa premix Taq polymerase (Clontech), 2.5 uL 0.2X Taqman pooled probe ...
-
bioRxiv - Molecular Biology 2019Quote: ... PCGF1-4) and CBX1-8 cDNAs were amplified from human ES cell cDNA library and inserted to pGAD-T7 (Takara, 630442) and pGBK-T7 (Takara ...
-
bioRxiv - Plant Biology 2020Quote: ... 5’ and 3’ RACE (rapid amplification of cDNA ends) were performed using the manufacturer’s instructions (Clontech).
-
bioRxiv - Immunology 2019Quote: ... RACE-ready cDNA synthesis was performed using the SMARTer RACE 5’/3’ Kit (Takara Bio USA) using primers with specificity to IgM ...
-
bioRxiv - Cell Biology 2019Quote: ... Antibodies used for this study were: mouse anti-GFP JL-8 (Clontech, 1:3000), rabbit anti-PfEF1α (from D ...
-
bioRxiv - Plant Biology 2020Quote: ... mTurq2cp was immunodetected with anti-GFP antibody (1:4000 dilution) (JL-8, #632380, Takara) and anti-mouse-HRP (1:15000 dilution ...
-
bioRxiv - Cell Biology 2023Quote: ... The following primary antibodies were used: mouse anti-GFP JL-8 (1:1000; TaKaRa), mouse anti-Tubulin AA4.3-c (1:5000 ...
-
bioRxiv - Molecular Biology 2022Quote: ... 4 μl of Ligation Mix (5 mM ATP, 7U Terminal Deoxynucleotidyl Transferase (TdT) (2230B, Takara), 15 U T4 RNA Ligase High Concentration (M0437 ...