Labshake search
Citations for Takara Bio :
401 - 450 of 2173 citations for 8 4 ethoxy 3 methoxyphenyl 1 5 diazabicyclo 3.2.1 octane since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2021Quote: ... DNA libraries were prepared using 1-5 ng of starting material using the SMARTer ThruPLEX DNA-Seq kit (Takara; R400674) according to manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2021Quote: ... sperm from 15 flies were dissected and pooled in 1:10 dilution of RNAse inhibitor (Recombinant ribonuclease inhibitor 5 000 U, Cat. 2313A Takara), and samples were flash-frozen on dry-ice ...
-
bioRxiv - Microbiology 2019Quote: ... A plasmid encoding a gene fusion between the 5‘-201 nucleotides of PR8 segment 5 and GFP was made by PCR-cloning the appropriate IAV sequence into pEGFP-1 (Clontech), followed by oligonucleotide-directed PCR mutagenesis (using standard protocols ...
-
bioRxiv - Genetics 2020Quote: ... The target vector and pEF1a-pac vector were co-transfected (5:1 ratio) to E14 mESCs using Xfect according to the manufacture’s instruction (TaKaRa, Inc). 48 hours after transfection ...
-
bioRxiv - Molecular Biology 2022Quote: ... The cDNAs (1-5 ng RNA equivalents) were used for real-time PCR amplification using SYBR Premix Ex Taq II (Takara/Clontech) on a 7500 Fast Real-Time PCR System (Applied Biosystems) ...
-
bioRxiv - Microbiology 2020Quote: ... Expression plasmids for Env and associated mutants in addition to Gag were natively expressed from the reference HIV-1 clone NL4-3 with the following modifications: the pNL4-3 vector was sub-cloned into an SV40 ori-containing backbone (pN1 vector; Clontech; pSVNL4-3), deletion of pol by removal of the BclI-NsiI fragment ...
-
bioRxiv - Cell Biology 2019Quote: ... using the two-hybrid system Matchmaker 3 from Clontech, strain AH109 was co-transformed with derivates of pGBKT7-DS and pGADT7-Sfi (Appendix Table S4 ...
-
bioRxiv - Immunology 2021Quote: ... and 3 U Recombinant RNase Inhibitor (Takara, Cat#2313A), sealed and immediately frozen on dry ice ...
-
bioRxiv - Microbiology 2023Quote: ... to amplify the 3’ end and CloneAmp (Takara Bio) for amplification of the 5’ end.
-
bioRxiv - Developmental Biology 2022Quote: A Smart-seq v4 3’ DE Kit (Takara Bio) was adapted to DRaqL as follows ...
-
bioRxiv - Cell Biology 2021Quote: ... and purified under denaturing condition (8 M urea) using the TALON metal affinity resin from Clontech. Purified fusion proteins were used to produce antibodies in guinea pigs from Covance Inc ...
-
bioRxiv - Neuroscience 2021Quote: 8 DIV (days in vitro) neurons were transfected with 1.5 µg of pEGFP-N1 vector (Clontech Laboratories ...
-
bioRxiv - Plant Biology 2021Quote: ... Detection of PHOT1-citrine was done using Living Colors anti-GFP antibody JL-8 (632381, Clontech), 1:4000 in PBS 5% milk 0,1% tween (PBSTM) ...
-
bioRxiv - Developmental Biology 2022Quote: Primary antibodies and concentrations used: mouse anti-GFP Living Colors (JL-8) (Takara Biosciences; cat# 632381) 1:500 dilution ...
-
bioRxiv - Genomics 2019Quote: ... and 5 mg/mL Doxycycline (Clontech).
-
bioRxiv - Microbiology 2021Quote: ... 5 Units of ExTaq enzyme (Takara) supplemented with 10 μM of ATTO-550-aminoallyl-dUTP (Jena bioscience) ...
-
bioRxiv - Developmental Biology 2023Quote: ... 5× PrimeScript™ RT mix (TaKaRa) was used to acquire cDNA ...
-
bioRxiv - Cell Biology 2023Quote: ... and pVSV-G (#PT3343-5, Clontech) vectors were transfected using Lipofectamine 3000 ...
-
bioRxiv - Neuroscience 2023Quote: ... 5) cDNA coding eGFP protein (Clontech). 6 ...
-
bioRxiv - Neuroscience 2024Quote: ... and individual cells were captured in separate wells of a 96-well plate containing 4 μl lysis buffer (1 U/μl RNase inhibitor [Clontech, Cat#: 2313B]), 0.1% Triton (Thermo Fisher Scientific ...
-
Orchestration of alternative splicing regulates bone marrow mesenchymal stem cells fate during agingbioRxiv - Cell Biology 2022Quote: ... bone sections were blocked in 5% bovine serum albumin (BSA) for 1 hour at room temperature and incubated with primary antibody to osteocalcin (Takara, M173) at 4°C overnight ...
-
bioRxiv - Molecular Biology 2020Quote: ... qRT-PCR was performed for gene expression using 2uL of 1:5 diluted cDNA with SYBR Green Realtime PCR Master Mix and Permix Ex Taq (Takara Bio), according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2022Quote: ... The cDNAs (1-5 ng RNA equivalents) were used for real-time PCR amplification using SYBR Premix Ex Taq II (Takara/Clontech) on a 7500 Fast Real-Time PCR System (Applied Biosystems) ...
-
bioRxiv - Plant Biology 2021Quote: ... whereas selective media additionally lacked His (−4) (Clontech).
-
bioRxiv - Molecular Biology 2020Quote: ... 4 μL of 5x PrimeScript buffer (Takara, USA), 1 μL RNAse OUT (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2022Quote: ... 4 ml of Lenti-X concentrator (Takara Bio) was added to 12 ml of cell supernatant and the mixture incubated at 4°C with gentle agitation for 18 hours ...
-
bioRxiv - Genomics 2022Quote: ... 3.5-4 million Lenti-X cells (Takara Bio) were seeded into 10 cm tissue culture dishes (Corning ...
-
bioRxiv - Molecular Biology 2024Quote: ... and 4 U recombinant inhibitor (Cat. 2313B, TaKaRa) or SEQURNA thermostable RNase inhibitor (Cat ...
-
bioRxiv - Microbiology 2020Quote: ... Western blotting was performed using standard procedures with the following primary antibodies: JL-8 monoclonal antibody (Takara) for GFP variants ...
-
bioRxiv - Microbiology 2023Quote: ... Standard immunoblotting procedures were performed using a primary antibody against GFP (mouse monoclonal JL-8 antibody, Takara) and a secondary antibody goat anti-mouse IgG-peroxidase antibody (Sigma) ...
-
bioRxiv - Plant Biology 2019Quote: ... Y2H assays were performed using the Matchmaker 3 system (Clontech). The resulting transformants with appropriate positive and negative controls were spotted on SD (-Leu/-Trp ...
-
bioRxiv - Cancer Biology 2020Quote: ... using the SMARTer™ ICELL8 3’ DE Kit (Takara Bio). Processing 8 samples at a time ...
-
bioRxiv - Systems Biology 2019Quote: ... and 3× PrimeScript enzyme mix (Cat# RR037A, TAKARA Bio INC) in RNase-free water ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... The 3’-RACE PCR was performed with ExTaq polymerase (TaKaRa) using the following primers ...
-
bioRxiv - Cell Biology 2024Quote: Human fetal heart RNA (n=3 pooled, Cat #636532, Takara) and human adult heart RNA (n=4 pooled ...
-
bioRxiv - Cell Biology 2020Quote: ... for 1 h at 4 °C with rotation and then transferred to gravity columns (Talon® 2 ml Disposable Gravity Column, Clontech, #635606-CLI). The lysate was drained and the beads were washed five times with cold wash buffer (50 mM Tris ...
-
bioRxiv - Biochemistry 2021Quote: ... After sonication and centrifugation (20 000 g, 1 h, 4 °C) the supernatant was mixed with Talon Metal Affinity Resin (Takara Bio USA, Inc.). After 1 hour incubation at 4 °C ...
-
bioRxiv - Biochemistry 2023Quote: ... ∼5 μg of bacmid were transfected using 5 μL of TransIT®-Insect transfection reagent (Takara Bio Inc.). 5 days after initial transfection ...
-
bioRxiv - Microbiology 2023Quote: ... After co-cultivation, the organoids were collected and resuspended in 4% paraformaldehyde (PFA, Servicebio, China) at 4℃ or RNAiso Plus (Takara, Japan) at -80℃ for further analysis ...
-
bioRxiv - Biophysics 2024Quote: ... for 35 min at 4°C and the supernatant was incubated overnight on the rotisserie at 4°C with TALON Cobalt Resin (Takara Bio). The next day the resin was washed with 10 column volumes of Purification Buffer and 10 column volumes of Purification Buffer with 10 mM imidazole before elution using Purification Buffer with 300 mM imidazole ...
-
bioRxiv - Genomics 2019Quote: The first-strand cDNA was synthetised from 1 μg of 5 tissues (root, stem, leaf, flower and peel) total RNA using Prime Script RT Reagent Kit (Takara, Dalian, China). The qRT-PCR reactions were performedin 96-well plates using the ABI 7500 fast Real-Time PCR system (Applied Biosystems ...
-
bioRxiv - Animal Behavior and Cognition 2019Quote: ... We froze 5 μL of the supernatant in 45 μL of Tris-EDTA buffer (10 mM Tris, 1 mM EDTA, Takara Bio Inc.) before analysis by polymerase chain reaction (PCR) ...
-
bioRxiv - Genomics 2019Quote: ... 4μl 5× First-Strand buffer (Takara, #639538), and 1μl B-tag-sw oligo ...
-
bioRxiv - Molecular Biology 2020Quote: ... 5 μL dNTPs (25 mM; Takara Bio), 1 μL primers (10 pmol/μL each primer) ...
-
bioRxiv - Immunology 2022Quote: 5 × 106 GP2-293 packaging cells (Clontech) were plated in a 10 cm dish containing D10 medium (DMEM supplemented with 10% FBS ...
-
bioRxiv - Neuroscience 2020Quote: ... 4µl 5× First-Strand buffer (Takara, #639538), and 1µl B-tag-sw oligo ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... the 5’-Full RACE Core Set (TaKaRa) was used to extend Rtl6 mRNA from the mouse brain at 8 weeks of age ...
-
bioRxiv - Plant Biology 2022Quote: ... 5 × PrimeScript™ RT Master Mix (TAKARA) was used to synthesize cDNA ...
-
bioRxiv - Cancer Biology 2020Quote: ... sgRNA sequences were amplified from 240μg of genomic DNA per sample with primers 5’AATGGACTATCATATGCTTACCGTAACTTGA AAGTATTTCG and 5’GTAATTCTTTAGTTTGTATGTCTGTTGCTAT TATG and ExTaq (Takara) polymerase ...
-
bioRxiv - Cell Biology 2023Quote: ... about ∼5 μg of bacmid were transfected using 5 μL of TransIT®-Insect transfection reagent (Takara Bio Inc.). 5 days after initial transfection ...