Labshake search
Citations for Takara Bio :
101 - 150 of 2554 citations for 3 Hydrazino 5 methyl 4H 1 2 4 triazol 4 ylamine hydrochloride since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2021Quote: ... 4 U and 8 U of MNase (TaKaRa 2910A) in MNase digestion buffer containing 20 mM Tris–HCl (pH 8.0) ...
-
bioRxiv - Genomics 2022Quote: ... 4 mL of lung tissue RNA (Takara Bio, 636524) at a final concentration of 500 pg per μl was used ...
-
bioRxiv - Immunology 2024Quote: ... and RNAse inhibitor (4 units) (Takara Bio, London, UK). After each plate was filled ...
-
bioRxiv - Biochemistry 2024Quote: ... 4 ml TALON cobalt resin slurry (Takara Bio Inc.) was added (1 ml/tube ...
-
bioRxiv - Molecular Biology 2022Quote: ... the 5′ and 3′’ untranslated regions (UTRs) of the virus were determined using a SMARTer®RACE 5′/3′ Kit (Takara Bio, USA). Viral RNA isolated in August ...
-
bioRxiv - Plant Biology 2023Quote: The cDNA prepared from 10-day-old OsbZIP48OE seedlings was used to perform 5’ and 3’ RACE using SMARTer® RACE 5’/3’ Kit (Clontech, TaKaRa Bio, USA) as per manufacturer’s instructions followed by Sanger based sequencing of the RACE products ...
-
bioRxiv - Microbiology 2023Quote: ... which was amplified by PCR from human cDNA using primers forward (5’-CAGTGTGGTGGAATTCACCATGTCAAGCTCTTCCTGGCT-3’) and reverse (5’-CACAAGATTTGGGCTCGGAAACAGGGGGCTGGTTAG-3’) and cloned into plasmid pVAX-IGHG1ΔCH1 by In-Fusion cloning (Takara Bio, San Jose, CA). This plasmid contains an Fc domain comprising Kabat numbers 226-478 of human IgG1 ...
-
bioRxiv - Microbiology 2024Quote: ... was used to determine 5’ and 3’ terminal nucleotide sequences of PcAEV4 and PcAEV5 with the SMARTer® RACE 5’/3’ Kit (Takara Bio USA) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2024Quote: ... The 21 bp barcodes were amplified with 5’-GGGATCACTCTCGGCATGG-3’ forward and 5’-CTGATCAGCGAGCTCTAGGAA-3’ reverse primers and PrimeSTAR GXL DNA polymerase (Takara Bio, Shiga, Japan). They were then sequenced with NextSeq 500 1×150 (Illumina ...
-
bioRxiv - Developmental Biology 2020Quote: ... embryos were incubated overnight at 4°C with rabbit anti-DsRed (1:500 in BB; Clontech 101004), mouse anti-Myh6 antibody (1:200 in BB ...
-
bioRxiv - Cell Biology 2022Quote: ... The extract was incubated for 1 h at 4 °C with Talon resin (Clontech, Mountain View, CA), loaded onto a column ...
-
bioRxiv - Developmental Biology 2020Quote: ... templates were constructed by cloning the 2 kb 5’ and 3’ homology arms into pPD95.77 plasmids using In-Fusion Advantage PCR cloning kit (Clontech, cat. no. 639621). We used the CRISPR design tool (http://crispr.mit.edu ...
-
bioRxiv - Plant Biology 2021Quote: ... benthamiana plants was used for 5’ RACE with SMARTer RACE 5’/3’ Kit (Takara, Japan) according to the manual booklet.
-
bioRxiv - Microbiology 2022Quote: ... the 5′-terminus of the viral genome was determined by 5′/3′ RACE kits (TaKaRa). The resulting whole genome sequence of the GX_P2V variant was deposited in GenBank (accession number MW532698) ...
-
bioRxiv - Plant Biology 2023Quote: The cDNA prepared from 10-day-old OsbZIP48OE seedlings was used to perform 5’ and 3’ RACE using SMARTer® RACE 5’/3’ Kit (Clontech, TaKaRa Bio, USA) as per manufacturer’s instructions followed by Sanger based sequencing of the RACE products ...
-
bioRxiv - Neuroscience 2023Quote: ... 5′-GCATGTCACGATGTTACAA-3′ and 5′-GGATGAAATGAAGGTGCTA-3′ as previously described50 and were inserted using the Infusion HD Cloning kit (Takara Bio USA Inc, NC1470242).
-
bioRxiv - Cancer Biology 2023Quote: Coding regions of the heavy-chain variable domains were amplified with two PAGE-purified primers (CALL001: 5’-GTCCTGGCTGCTCTTCTACAAGG-3’ and CALL002: 5’-GGTACGTGCTGTTGAACTGTTCC-3’) using LA Taq polymerase (TAKARA Bio Inc., Shiga, Japan). The amplified fragments were separated on a 1.5% low-melting-temperature agarose gel (Lonza Group AG ...
-
bioRxiv - Microbiology 2024Quote: The SMARTer® RACE 5’/3’ kit (Takara Bio, USA) was used to generate cDNA according to the manufacturer’s instructions using a maPgV-specific reverse primer (TGCGAGAGCCGTCAGCCACA) ...
-
bioRxiv - Biochemistry 2021Quote: ... then incubated at 4 °C in Lenti-X Concentrator (Clontech) for 1 h ...
-
bioRxiv - Genomics 2023Quote: ... 4 µl of Dr.GenTLE precipitation carrier (Takara, cat. no. 9094) and 4 µl sodium acetate ...
-
bioRxiv - Plant Biology 2020Quote: ... which contained 4 µL of lysis buffer with 1 U/µL of Recombinant RNase Inhibitor (RRI, Clontech 2313B), 0.1% [w/v] Triton X-100 (Thermo Scientific 85111) ...
-
bioRxiv - Immunology 2023Quote: Non-tissue culture treated 12-well plates were coated overnight at 4°C with 1 ml Retronectin (Takara) at 25 μg/ml in PBS ...
-
bioRxiv - Immunology 2024Quote: 5’ RACE of lncRNA VILMIR was performed using the SMARTer RACE 5’/3’ Kit (Takara, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... and was then incubated with 2 mL TBS pH 8.0 pre-equilibrated Talon® Metal Affinity resin during 2 h at 4°C in a vertical rotating mixer (Takara Bio, Kusatsu, Japan). The resin was washed with 10 volumes of TBS pH 8.0 buffer containing 0.1% Triton X-100 and 10 mM imidazol (both from Sigma) ...
-
bioRxiv - Microbiology 2020Quote: ... SARS-CoV-2 RBDs were purified using 1 or 5 ml HisTALON superflow cartridges (Takara Bio) and subsequently buffer exchanged into Cytiva 1x HBS- N buffer or PBS.
-
bioRxiv - Microbiology 2021Quote: ... SARS-CoV-2 RBDs were purified using 1 or 5 mL HisTALON superflow cartridges (Takara Bio) and subsequently buffer exchanged into 1x HBS-N buffer (Cytiva ...
-
bioRxiv - Cell Biology 2020Quote: ... Total normal liver RNAs were obtained from 5 donors pool (Biochain, Newark, CA) and from 4 donors pool (Takara BioUSA, Mountain View, CA, USA). 3 μg of total RNA were used for reverse transcription to obtain cDNA and real-time PCR performed ...
-
bioRxiv - Neuroscience 2020Quote: Genomic-free total RNA was isolated from a separate cohort of E15.5 sham control and IUGR hippocampi (n=4-5/each treatment) using Nucleospin RNA protocol (Takara Bio USA, Mountain View, CA). Total RNA was quantified with a Nanodrop spectrophotometer ND-1000 (Wilmington ...
-
bioRxiv - Molecular Biology 2020Quote: RACE assay was performed with SMARTer RACE 5’/3’ kit (Clontech) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2021Quote: ... The SMARTer® RACE 5’/3’ Kit was purchased from Clontech Laboratories ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... SMARTer® RACE 5’/3’ Kit was used (Takara Bio, Japan). Prior to the reaction ...
-
bioRxiv - Microbiology 2024Quote: ... 5′ RACE was carried out using SMARTer RACE 5′/3′ Kit (Takara Bio USA, Mountain View, CA) to identify the transcription start site (TSS ...
-
bioRxiv - Biophysics 2022Quote: ... 3’-RACE-Ready cDNA template was synthesized using a SMARTer® RACE 5’/3’ Kit (Takara Bio, USA) and subsequently used to amplify 3’ end sequences of R ...
-
bioRxiv - Neuroscience 2021Quote: ... followed by an incubation overnight at 4°C with antiDsRed rabbit polyclonal primary antibody (1:1000, 632496 Takara Bio) diluted in a triton buffer (0.3% Triton X-100 diluted in PBS-DEPC) ...
-
bioRxiv - Neuroscience 2021Quote: ... followed by an incubation overnight at 4°C with antiDsRed rabbit polyclonal primary antibody (1:1000, 632496 Takara Bio) diluted in a triton buffer (0.3% Triton X-100 diluted in PBS-DEPC) ...
-
bioRxiv - Biophysics 2021Quote: ... The resulting supernatant was collected by ultracentrifugation (150,000 × g, 1 hour, 4 °C) and applied onto an immobilized metal-ion affinity chromatography column (Talon, Clontech) equilibrated with 40 mM Tris ...
-
bioRxiv - Immunology 2020Quote: ... non-tissue culture treated 96-well plates were coated overnight at 4 °C with 1 ml of retronectin (Takara) at 25μg/ml in PBS ...
-
bioRxiv - Developmental Biology 2023Quote: ... They were then incubated O/N at 4°C with the corresponding primary antibody: anti-DsRed (1:500; Clontech), mouse anti-GFP ([1:100] ...
-
bioRxiv - Cancer Biology 2024Quote: ... sections were stained overnight in 4°C with primary antibodies: human cytoplasmic antigen (1:1000, clone STEM121, Takara, Y40410), OLIG2 (1:1000 ...
-
bioRxiv - Microbiology 2022Quote: ... expression was induced by addition of 4 ng/ml anhydrotetracycline (Clontech) at 4 hpi.
-
bioRxiv - Microbiology 2021Quote: ... 4 μl of 5X In-Fusion premix (Takara Bio, cat#638909), and milliQ water up to 20 μl ...
-
bioRxiv - Microbiology 2024Quote: ... Transfection was performed using 4 µL TransIT 293 (Takara, Shiga, Japan) and 100 µL OPTI-MEM (Thermo Fisher Scientific) ...
-
bioRxiv - Bioengineering 2024Quote: ... cerevisiae SH-4 cells using NucleoSpin RNA (Takara Bio, Otsu, Japan) and Quick-RNA MiniPrep Plus (Zymo Research The MGIEasy RNA Directional Library Prep Set (MGI Tech ...
-
bioRxiv - Immunology 2022Quote: ... First-strand cDNA was generated from 1 μg of RNA for each sample using the SMARTer RACE 5’/3’ Kit (Takara Bio ...
-
bioRxiv - Microbiology 2023Quote: ... 5’RACE was performed with SMARTer RACE 5’/3’ Kit (Takara Bio USA, Inc. San Jose, CA USA) according to the manufacturer’s directions.
-
bioRxiv - Plant Biology 2022Quote: CRISIS2 or Nb14-3-3 was fused with the Gal4 DNA binding domain in pGBKT7 (Clontech, PT3248-5, USA) and inserted into the Saccharomyces cerevisiae Y2HGold strain (Clontech ...
-
bioRxiv - Cancer Biology 2023Quote: ... Membranes were blocked as above and then incubated overnight at 4 °C with appropriate antibodies to GFP (1:1000 dilution; Clontech, Catalog No. 1. 632381) and tubulin α (1:2000 dilution ...
-
bioRxiv - Neuroscience 2020Quote: ... and 0.3% Triton X-100 in PBS and then stained with a primary antibody for 48 hours at 4°C with agitation in blocking buffer: DsRed (anti-rabbit, 1:5000, cat. number NC9580775, Takara), GFP (anti-chicken ...
-
bioRxiv - Neuroscience 2021Quote: ... Then the nuclei were centrifuged at 500 x g for 5 minutes at 4°C and washed in 4 ml Nuclei Suspension Buffer (NBS; consisting of 1× PBS, 0.04% BSA and 0.1% RNase inhibitor (Clontech, Cat #2313A)) ...
-
bioRxiv - Genetics 2020Quote: ... The beads were then suspended in TdT reaction buffer (1× NEBuffer #4, 0.25 mM CoCl2, 15 U TdT (Takara Bio), 20 Ci α-32P-dCTP [6000 Ci/mmol]) ...