Labshake search
Citations for Takara Bio :
51 - 100 of 2554 citations for 3 Hydrazino 5 methyl 4H 1 2 4 triazol 4 ylamine hydrochloride since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: The full-sized CP190 (aa 1096) was PCR-amplified using primers 5’-ttcccgggcatgggtgaagtcaagtccg-3’ and 5’-tttggaggagctatatttactaagatct-3’ and subcloned into pGAD424 vector (Clontech) in frame with activation domain of GAL4 using restriction sites SmaI and BamHI ...
-
bioRxiv - Genomics 2020Quote: ... 10 μL of which was subject to PCR with primer pair 5′- AATGATACGGCGACCACCGAGATCT-ACACTCTTTCCCTACACGACGCTCTTCCGATCT-3′ and 5′-CAAGCAGAAGACGGCATACGAGAT-CTGATC-TGACTGGAGTTCAGACGTGTGCTCTTCCGATCT-GCTGCGCTCGATGCAAAATA-3′ using PrimeSTAR Max PCR master mix (R045A, Takara) to add sequencing adapter sequences to CASB barcode.
-
bioRxiv - Developmental Biology 2020Quote: ... mCherry cDNA was amplified using primers NheI mCherry Fw (5’-acgctagctatggtgagcaagggcgaggag-3’) and XhoI mCherry Rv (5’-gactcgagttacttgtacagctcgtccat-3’) from mCherry Vector (Clontech), and then the product was introduced into NheI-XhoI sites of the pFRT-SV40-FRT vector (Gift from Elizabeth R ...
-
bioRxiv - Cell Biology 2021Quote: ... PCR amplification was carried out with primers (Forward: 5’-AGGCAGTGAGTGAAGTGT -3’, Reverse: 5’-TAAGTTGGCGAGGCTTGA -3’) using PrimeSTAR HS DNA Polymerase (DR010A, Takara) under the following conditions ...
-
bioRxiv - Biophysics 2022Quote: ... 5’ and 3’-RACE-Ready cDNA templates were synthesized using a SMARTer® RACE 5’/3’ Kit (Takara Bio, USA) and subsequently used to amplify 5’ and 3’ end sequences of P ...
-
bioRxiv - Neuroscience 2021Quote: ... the promoter pgrd-10 was amplified from fosmid WRM0612bC07 using 5’-ccatgattacgccaatcgtcatc-3’ and 5’-tggccaatcccggggtttttaga-3’ and cloned with Gateway backbone amplified using 5’-ccccgggattggcca-3’ and 5’-ttggcgtaatcatgg-3’ to make pgrd-10∷GW [pNBRGWY151] using infusion cloning(Takara). It was then recombined with ced-10 WT[pNBRGWY88] using LR recombination (Invitrogen).
-
bioRxiv - Molecular Biology 2023Quote: ... and those targeting the Alu repeat sequence in the nuclear genome (5′-CTTGCAGTGAGCCGAGATT-3′ and 5′- GAGACGGAGTCTCGCTCTGTC-3′) (75) with TB Green Premix Ex Taq II (TaKaRa) on Thermal Cycler Dice Real Time System II (TaKaRa) ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... We amplified a 1.4 kb genomic fragment with PCR primers AIP3F (5’- GGCGCTATACCCGCTCGTGTCC-3’) and AIP5R2 (5’-CTTCATATTTGAAGACGAGGGAGG-3’) using 10 ng genomic DNA and Advantage DNA polymerase (Clontech) with the following cycling conditions ...
-
bioRxiv - Cell Biology 2023Quote: ... was PCR-amplified with the primer set (fwd: 5’- CTTCGAATTCTGGCCACCATGGCTGCCGCCACCACC-3’, rev: 5’- CGGTGGATCCccCAAGAAATCCTTGATGTTAAGATCCGCTAATGG-3’) and inserted into EcoRI and BamHI sites of pmCherry-N1 (Clontech) by restriction digestion and T4 ligation ...
-
bioRxiv - Microbiology 2023Quote: ... The V1-V2 variable region of stool DNA was amplified by universal primer set 27F-mod (5’-AGRGTTTGATYMTGGCTCAG-3’) and 338R (5’-TGCTGCCTCCCGTAGGAGT-3’) using Gflex DNA polymerase (Takara) 37 ...
-
bioRxiv - Neuroscience 2024Quote: ... Full-length of itga2 was inserted into the Sfi IA (5′-GGCCATTACGGCC-3′) and Sfi IB (3′-GGCCGCCTCGGCC-5′) sites of the “prey” pPR3-C vector (Clontech). Series of combinations of bait and prey constructs were cotransformed into the yeast strain NMY51 (Clontech) ...
-
bioRxiv - Biophysics 2021Quote: ... denatured at 85°C for 5 minutes and annealed at 47.5°C for 4 hours in a PCR machine (Takara-Bio). The folded DNA origami was then agarose-gel-purified (Douglas et al ...
-
bioRxiv - Genomics 2020Quote: ... corresponding primers (Supplementary Table 3-4), Phanta Max Super-fidelity DNA Polymerase (Cat. No. P505-d1, Vazyme) or KOD plus (Cat. No. F0934K, Takara, Kyoto, Japan) with a touchdown cycling protocol that contains 30 cycles of 98 °C for 10 s ...
-
bioRxiv - Cell Biology 2021Quote: ... Sanger sequencing was performed after PCR amplification with appropriate primers (Fw#3 and Rv#4, S1 Table) and PrimeSTAR HS DNA Polymerase (Takara, Kyoto, Japan).
-
bioRxiv - Cancer Biology 2024Quote: ... we employed the MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) or WST-1 (Water-Soluble Tetrazolium 1) assay from Takara, Japan ...
-
bioRxiv - Molecular Biology 2020Quote: ... 5′ RACE was performed using the SMARTer RACE 5/3 kit (Takara Bio) according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2021Quote: ... whereas selective media additionally lacked His (−4) (Clontech).
-
bioRxiv - Molecular Biology 2020Quote: ... 4 μL of 5x PrimeScript buffer (Takara, USA), 1 μL RNAse OUT (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2024Quote: ... and 4 U recombinant inhibitor (Cat. 2313B, TaKaRa) or SEQURNA thermostable RNase inhibitor (Cat ...
-
bioRxiv - Molecular Biology 2022Quote: ... 4 ml of Lenti-X concentrator (Takara Bio) was added to 12 ml of cell supernatant and the mixture incubated at 4°C with gentle agitation for 18 hours ...
-
bioRxiv - Genomics 2022Quote: ... 3.5-4 million Lenti-X cells (Takara Bio) were seeded into 10 cm tissue culture dishes (Corning ...
-
bioRxiv - Bioengineering 2024Quote: ... and secretion signal 4 from pBIC4 (Takara, Japan) were incorporated upstream of the Lc and Hc genes ...
-
bioRxiv - Genetics 2021Quote: Adult ovary total RNA was used to amplify the 5’ and 3’ UTR of Pxmeiw68 and PxnanosP using the SMARTer RACE 5’/3’ Kit (Takara, Japan). 5’ and 3’ regulatory sequences were then cloned from 4th instar larval gDNA ...
-
bioRxiv - Evolutionary Biology 2021Quote: First amplified with primers 27F (5’-AGAGTTTGATCMTGGCTCAG-3’) and 1492R (5’-GGTTACCTTGTTACGACTT-3’) using EmeraldAmp GT PCR Master Mix (TAKARA BIO) to minimize the amplification of non-bacterial taxa under the following cycling conditions ...
-
bioRxiv - Biochemistry 2020Quote: ... The target 23-mer sequences for sgRNA used were 5’-TTTACCTTGATAGGTGGTAGTGG - 3’and 5’-ATAAAGAGAGGCTTCTCGGGAGG - 3’ and synthesized using Guide-it™ sgRNA In Vitro Transcription Kit (TaKaRa) according to manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2021Quote: ... D4H was generated by site-directed mutagenesis using the primers 5’-TGTTTTAGATTGATAATTTCCATCCCATGTTTT-3’ and 5’-CGGACTCAGATCTCGAAGGGAAAAATAAACTTAGA-3’ and inserted into pEGFP-C2 vector (TaKaRa Bio) by the In-Fusion reaction ...
-
bioRxiv - Cell Biology 2021Quote: ... was amplified from HEK293 cDNA by PCR using the primers 5’-TGTAAGCTTTTCGACACCACACCCCACTC-3’ and 5’-AGAGAATTCTCAGGAAAAGCTGTCATCGG-3’ and was inserted into pEGFP-C3 vector (TaKaRa Bio) using EcoRI and HindIII ...
-
bioRxiv - Neuroscience 2022Quote: ... sad-1 was cloned into PCR8 vector using the following primers 5’ TCCGAATTCGCCCTTCGTCAATCGGGCAAAGTC 3’ and 3 ’GTCGAATTCGCCCTTGATGATAGATTAGACTTTATCAGCC 5’ with help of infusion reaction (Takara, 638947). For making Pmec-7::mec-7::gfp (cDNA ...
-
bioRxiv - Animal Behavior and Cognition 2024Quote: ... with the PCR product of the W56-EGFP-Linker-Synapsin1a region from pAAV-hSyn1-W56-EGFP-Linker-Synapsin1a (FWD and REV primers: 5’-GGCGCGCCCTAGAATTTCAGTCGGAGAAGAGGCTGGC-3’ and 5’-ATGCTAGGCCACCATGATGGTGGACGGCAAGCCC-3’, respectively) using In-Fusion cloning (TaKaRa Bio). pAAV-hSyn1-DIO-Scr-EGFP-Linker-Synapsin1a was generated by replacing the TurboID region of pAAV-hSyn1-DIO-TurboID (EcoRI/NcoI sites ...
-
bioRxiv - Biochemistry 2024Quote: ... for A3>P: 5’-aaaacacugaaccug-3’ for A2>P: 5’-aaacacugaaccug-3’) were incubated with 10 U recombinant MazF (Takara Bio) in 20 mM Tris pH 8.0 ...
-
bioRxiv - Genetics 2024Quote: ... The 4–11 kb fragments of the DFR-B sequence were amplified by PCR using the primers DP-LF (5′-TTAACATGAGGGGATTGCATGTCACTTTCA-3′) and D3U-LR (5′-CATAAATCTGGTTCGAGTGGCAATCTAACT-3′) with Ex-Premier DNA Polymerase (TAKARA, Japan). The PCR conditions were as follows ...
-
bioRxiv - Immunology 2024Quote: ... T cells were activated for 2 days and NK cells were activated for 4 days followed by retronectin (Takara, T100B) mediated viral transduction ...
-
bioRxiv - Cancer Biology 2022Quote: ... 4×106 B cells per well were plated in 2 mL on 6-well plates that had been coated with RetroNectin (25 μg/mL, 4°C, overnight; #T100B, Takara), blocked with 2% BSA in PBS (1h ...
-
bioRxiv - Neuroscience 2024Quote: ... and Doxycycline Hydrochloride (1ug/ml, 631311, Clontech). Plates are fixed in 4%PFA ...
-
bioRxiv - Neuroscience 2024Quote: ... and Doxycycline Hydrochloride (1ug/ml, 631311, Clontech). Progenitor cells were cryopreserved for future use in micronic vials in CryoStorCS10 (07930 ...
-
bioRxiv - Biophysics 2024Quote: ... for 35 min at 4°C and the supernatant was incubated overnight on the rotisserie at 4°C with TALON Cobalt Resin (Takara Bio). The next day the resin was washed with 10 column volumes of Purification Buffer and 10 column volumes of Purification Buffer with 10 mM imidazole before elution using Purification Buffer with 300 mM imidazole ...
-
bioRxiv - Microbiology 2024Quote: ... After co-cultivation, the organoids were collected and resuspended in 4% paraformaldehyde (PFA, Servicebio, China) at 4 [or RNAiso Plus (Takara, Japan) at −80□ for further analysis ...
-
bioRxiv - Molecular Biology 2020Quote: ... was amplified using specific primers (forward: 5’-AAGGAGATATACATATGCTCTCCGAAATGGTGGAAGAAG-3’; reverse:5’-GTGCGGCCGCAAGCTTTTATTTCTTTTTGTTGGTGGTCTG-3’) and cloned into pET28a using an InFusion HD Cloning Kit (Takara Bio USA) as per the manufacturer’s instructions ...
-
bioRxiv - Genetics 2020Quote: ... To determine the 5’ and 3’ UTR of the sds3 gene 5’ and 3’ Rapid amplification of cDNA ends (RACE) was performed using the SMARTer® RACE 5’/3’ Kit (Takara Bio) on RNA isolated using Trizol (Life Technologies ...
-
bioRxiv - Microbiology 2021Quote: ... Primers used for amplifying the insert (5’-TACTTCCAATCCAATGTAGATATAAACAACAATAAGATTAGC-3’ and 5’- TTATCCACTTCCAATGAGATAACCTTGTACATCATCTGTATGC-3’) contained 15-bp overhang with homology to the plasmid for InFusion cloning (Takara Bio, 638947). The resulting plasmid ...
-
bioRxiv - Microbiology 2021Quote: ... Primers used to amplify this region (5’-ATTGCGACACGTACTCTGCAGATCTCATACCATCATAGTTATAATATTAGC-3’ and 5’-AGAGGATCCCCATGGCTGCAGACACAGGTGTCGTCATTGTGA-3’) contained 15-bp overhang with homology to the plasmid for InFusion (Takara Bio, 638947) cloning and retained the Pst1 site ...
-
bioRxiv - Microbiology 2023Quote: The 5’ and 3’ termini of the sRNA OueS were determined by the RACE assay (SMARTer RACE 5’/3’ kit, Takara Bio USA), adapted for non-poly-A-tailed RNA ...
-
bioRxiv - Plant Biology 2022Quote: ... The qRT-PCR was performed with the reversed cDNAs as substrates and the MeSWEET10a specific primers (F: 5’-TCCTCACCTTGACTGCGCTG-3’; R: 5’-AGCACCATCTGGACAATCCCA-3’) by using the SYBR Premix Taq Kit (TaKaRa, Dalian, China) in the ABI7500 Real-Time PCR System (Applied Biosystems ...
-
bioRxiv - Microbiology 2024Quote: The 5’ and 3’ termini of the sRNA OueS were determined by the RACE assay (SMARTer RACE 5’/3’ kit, Takara Bio USA), adapted for non-poly-A-tailed RNA ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5’ RACE cDNA library was prepared using Clontech SMARTer RACE 5’/3’ Kit (Takara) according to the user manual with the gene-specific primer (S4 Table ...
-
bioRxiv - Immunology 2023Quote: ... The mixture was then chilled on ice for 2 min and then mixed with 4 μl 5x first-strand buffer (Takara Bio), 2 μl 100 mM DTT ...
-
bioRxiv - Zoology 2021Quote: ... The 3′-RACE assay was performed using the SMARTer RACE 5′/3′ Kit (CA94043, TaKara) following the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2021Quote: ... The membranes were blocked in 5% non-fat milk in TBST for 1 h and immunoblotted with antibodies against GFP (anti-GFP.1, 4°C overnight, Takara Bio Clontech ...
-
bioRxiv - Cell Biology 2021Quote: ... The membranes were blocked in 5% non-fat milk in TBST for 1 h and immunoblotted with antibodies against GFP (anti-GFP.1, 4°C overnight, Takara Bio Clontech, 632381 or anti-GFP.2 ...
-
bioRxiv - Neuroscience 2024Quote: ... Lentivirus-containing conditioned media were centrifuged at 500 x g for 5 min at 4°C to remove cellular debris and concentrated using Takara LentiX (Takara Cat# 631231). Briefly ...