Labshake search
Citations for Takara Bio :
101 - 150 of 2428 citations for 2 1 ethylpentyl 1 3 dioxan 5 yl laurate since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: Interactions between CDK-2 and COSA-1 were assayed using the Matchmaker Gold Yeast Two-Hybrid System (Clontech PT4084-1). CDK-2 and COSA-1 cDNAs were amplified from a C ...
-
Potential for virus endogenization in humans through testicular germ cell infection: the case of HIVbioRxiv - Microbiology 2020Quote: ... VSV G-pseudotyped HIV-1 using full-length HIV-1 molecular clone pNL4-3 [79] or the R5-tropic pNL4-3 AD8 derivative [80] and VSV-G envelope encoding plasmid (PT3343-5, Clontech); 4 ...
-
bioRxiv - Molecular Biology 2020Quote: ... The FOXR1 wild-type and M280L mutant were then PCR amplified using forward 5′-AAAGCACTCGAGATGGGGAACGAGCTCTTTCTG-3’andreverse5’-TTTGGCCCGCGGTTAAAGATCAAAGAGGAAGGG-3’ primers and subcloned into the XhoI and SacII restriction sites of pEGFP-C3 (Clontech) to create an N-terminal EGFP tag ...
-
bioRxiv - Cell Biology 2020Quote: ... with 5’-cgGAATTCaccATGgagcagaagctc atctcagaagaagacctcggtAAGGATAACACCGTGCC-3’ and 5’-ataagaatGCGGCCGCtaaact ATTATTTTTCTGCACTACGCAGG-3’ followed by cloning into the EcoRI and Not I sites of pIRESpuro3 (Clontech) creating pIRESpuro3-myc-BirA ...
-
bioRxiv - Molecular Biology 2023Quote: ... the 3’ UTR of the virus were determined using the SMARTer®RACE 5’/3’ Kit (Takara Bio, Kusatsu, Japan). 2.4 µg of RGMoV gRNA was polyadenylated using Poly(A)polymerase (600 u/µl ...
-
bioRxiv - Cell Biology 2021Quote: ... the annealed oligo duplex at a 1:3 mol ratio and ligation mix (Takara Bio) at 16 °C for 30 min ...
-
bioRxiv - Cancer Biology 2024Quote: 1 x 106 ACKP cells were transfected with 3 µg pE2F-TA-luc plasmid (Takara) and 0.3 µg renilla luciferase control plasmid pRL-CMV (Promega ...
-
bioRxiv - Plant Biology 2020Quote: ... according to the manufacturer’s instructions (SMARTer® RACE 5’/3’ Kit, Clontech, USA), with gene specific primers (YFT1-GSP5′-R/GSP3′-F ...
-
bioRxiv - Cell Biology 2021Quote: ... and 5’- GAGCTCTAGGATATCGAATTCTCGAGTCACTTGCACAGGGCCTCCAACACC-3’ and inserted into the pLVSIN vector (Takara Bio, Japan) by HiFi assembly (New England Biolabs ...
-
bioRxiv - Neuroscience 2023Quote: ... and CaMKK2 (5’-CCCTTTCATGGATGAACGAAT-3’) were cloned into pBAsi-hH1 vector (Takara, 3220). pCAG-AMPKα1(WT ...
-
bioRxiv - Developmental Biology 2022Quote: ... For RACE analysis we used the SMARTer® RACE 5’/3’ Kit (Takara) according to manufacturer’s recommendations (see Supplementary Table 8 for the list of primers used).
-
bioRxiv - Microbiology 2023Quote: ... The RACE experiment was carried out using SMARTer RACE 5’/3’ Kit (Clontech) according to the manufacturer’s instructions.
-
bioRxiv - Microbiology 2023Quote: ... cDNA was synthesized using SMARTer RACE 5’/3’ Kit (Takara Bio, Shiga, Japan). ssRNA was converted into cDNA using SMARTer Universal Low Input RNA Kit according to the manufacturer’s protocol (Takara Bio) ...
-
bioRxiv - Physiology 2024Quote: 5’ and 3’ RACE assays were performed using a SMARTer RACE kit (Clontech) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2024Quote: ... 800 ng RNA was used with the SMARTer RACE 5’/3’ kit (Takara) following manufacturer instructions ...
-
Dynamic states of eIF6 and SDS variants modulate interactions with uL14 of the 60S ribosomal subunitbioRxiv - Biochemistry 2022Quote: ... pRSFDUET-1-EIF6 plasmid was co-transformed with pG-KJE8 expressing five bacterial chaperones (5-Ch: DnaK-DnaJ-GrpE, GroES, GroEL) or pG-TF2 expressing 3 bacterial chaperones (3-Ch: GroES, GroEL, TF) (Takara Biosciences) in BL21 (DE3 ...
-
bioRxiv - Molecular Biology 2024Quote: ... synthesized 5’ and 3’ fragments of the target RNA were 32P-radiolabeled at the 5’ end using T4 polynucleotide kinase (Takara). After gel purification ...
-
bioRxiv - Microbiology 2021Quote: ... 1 μl of cDNA was amplified using Advantage HF 2 DNA polymerase (Takara) for 25-30 cycles according to the manufacturer’s instructions (Fw 5’-GGGATTAAAGGTTTATACCTTCCC-3’ and Rv 5’-TCGTTGAAACCAGGGACAAG-3’) ...
-
bioRxiv - Developmental Biology 2024Quote: ... rat monoclonal anti-E-cadherin antibody (ECCD-2) (1:200) (Takara, Cat# M108), mouse monoclonal anti-Yap1 antibody (MO1 ...
-
bioRxiv - Neuroscience 2020Quote: ... 0.125 μl Takara Ex Taq DNA Polymerase (5 U μl-1) (TaKaRa, Shiga, Japan), 2 μl of DNA and 15.67 μl nuclease-free water ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... with 0.1 µL of Taq Polymerase 5 U.µL-1 (TaKaRa Ex Taq® Kit MgCl2 Free Buffer) (TaKaRa Ex Taq, TaKaRa Bio, Shiga, Japan), 2.5 µL PCR Buffer 10X ...
-
bioRxiv - Pathology 2024Quote: ... ENTV-1 and ENTV-2 were amplified by PCR (Table 2) using the high-fidelity DNA polymerase “PrimeStar GXL” (Takara), with primers targeting exogenous β-retroviruses ...
-
bioRxiv - Microbiology 2021Quote: ... Primers used for amplifying insert (5’- CACAGAGAACAGATTGGTGGATCCATGGTAGATATAAACAACAATAAGATTAG-3’ and 5’-GTGGTGGTGGTGGTGTAACTCGAGGAGATAACCTTGTACATCATCTGTAT GC-3’) contained 15-bp overhang with homology to the plasmid for InFusion cloning (Takara Bio, 638947). The resulting plasmid ...
-
bioRxiv - Synthetic Biology 2020Quote: ... The deletion of the lacZ gene was verified using blue-white selection on an LB agar plate containing 0.1 mM isopropyl-β-D-thiogalactopyranoside (Nacalai Tesque) and 4.0 × 10−3 % 5-bromo-4-chloro-3-indolyl-β-D-galactoside (Takara Bio).
-
bioRxiv - Neuroscience 2023Quote: ... with primers 5’-TCTTCCACTAGTGCCACCATGGCCACAGCTTGTAAAAGATC-3’ and 5’-TCTTCCGGATCCTTACAGCATGCCAAATCCTTTGG-3’ and subcloning into the SpeI and BamHI sites of the pLVX-IRES-mCherry vector (Clontech Cat#631237). HEK293T cells were transfected in 96-well using Lipofectamine 3000 Reagent (ThermoFisher ...
-
bioRxiv - Microbiology 2020Quote: ... The 5’ RACE reaction was performed with an ac13-specific primer (ac13-GSP1) using a SMARTer® RACE 5’/3’ Kit (TaKaRa) according to the manufacturer’s protocol ...
-
bioRxiv - Evolutionary Biology 2023Quote: Complete cDNA sequences of taste receptors were obtained using a SMARTer 5’/3’ kit for RACE PCR to obtain 5’ sequence information missing from reference transcriptome (Takara, #634858). Briefly ...
-
bioRxiv - Microbiology 2020Quote: ... 5 μl 2×SYBR®Premix Ex Taq™ II (TaKaRa), 0.75 μM primers and nuclease-free water to 20 μl ...
-
bioRxiv - Plant Biology 2022Quote: ... 2 μL of 5× PrimeSTAR GXL Buffer (Takara Bio, Kusatsu, Japan), 1.0 μL of PrimeSTAR GXL DNA Polymerase (1.25 U/μL) ...
-
bioRxiv - Microbiology 2021Quote: ... we performed RACE PCR using a SMARTer® RACE 5’/3’ Kit (Takara Bio), according to the manufacturer’s specifications ...
-
bioRxiv - Genetics 2020Quote: ... A 3′-dephosphorylation and 5′-phosphorylation reaction was performed using T4 PNK enzyme (TaKaRa). The enzyme was removed by phenol-chloroform purification ...
-
bioRxiv - Neuroscience 2024Quote: ... cDNAs were cloned using the SMARTer RACE 5’/3’ Kit (Takara, Cat No. 634858) and then sequenced (Beijing Genomics Institution ...
-
bioRxiv - Bioengineering 2022Quote: ... 1 µl purified cDNA was amplified with an Advantage HF 2 PCR kit (Takara) in a 25 µl reaction containing 0.5 µl forward primer (10 µM ...
-
bioRxiv - Cell Biology 2021Quote: ... Fibroblast cultures at passage 3 were cryopreserved by suspending cells in CELLBANKER 1 (Takara Bio, Shiga, Japan), slowly cooled to -80 °C using a Mr ...
-
bioRxiv - Microbiology 2022Quote: ... Membrane was immunoblotted for ≥ 3 h with primary monoclonal anti-GFP (1:5,000) antibodies (JL8, Clontech-Takara), then followed by immunoblotting for ≤ 1 h with secondary antibodies ...
-
bioRxiv - Microbiology 2022Quote: ... Membrane was immunoblotted for ≥ 3 h with primary monoclonal anti-GFP (1:5,000) antibodies (JL8, Clontech-Takara), then followed by immunoblotting for ≤ 1 h with secondary antibodies ...
-
bioRxiv - Neuroscience 2021Quote: ... 3% normal goat serum (NGS) and then incubated overnight with 1:2000 rabbit-anti-DsRed (632496, Clontech) (Geerling et al. ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... we made a master mix using the primers 2550F = 5’-GTT ACT GAT TCG TCT ACG AGA-3’ and 2718R = 5’-ATT GAA ATG ATC CAG TGC TTG-3’ and TaKaRa ExTaq DNA Polymerase (Takara Bio USA, Inc). We ran the samples for 31 cycles and ran the PCR product on a 2% agarose gel.
-
bioRxiv - Microbiology 2020Quote: ... single-stranded (ss) cDNA (sscDNA) was synthesized using the SMARTer RACE 5′/3′ Kit (Takara) with a U2-complementary primer ...
-
bioRxiv - Microbiology 2020Quote: ... The terminal sequences were recovered using a SMARTer® RACE 5’/3’ Kit (Takara, Japan) according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2023Quote: Rapid amplification of cDNA ends was performed using the SMARTerR RACE 5’/3’kit (Takara), us 1 μg of DNA-free RNA from zeocin-treated samples as template for first-strand cDNA synthesis according to manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2024Quote: 3’ and 5’RACE reactions were carried out using the SMARTer 3’5’ RACE kit (Takara), essentially as recommended by the manufacturer ...
-
bioRxiv - Plant Biology 2024Quote: ... which was performed using a SMARTer RACE 5’/3’ Kit (Clontech Laboratories, Mountain View, CA) according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2021Quote: Transcription start sites were characterised by cloning and sequencing 5’ RACE products using the SMARTer RACE 5’/3’ kit (Takara Bio USA, Inc). In summary ...
-
bioRxiv - Cancer Biology 2022Quote: ... filtered through 0.45 μm syringe filters (Starlab) and concentrated using 1/3 volume of Lenti-X concentrator (Clontech) as per the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2023Quote: ... 1 μg total RNA was reverse transcribed into cDNA with the SMARTer RACE 5’ Kit (Clontech). PCR was performed using primer GSP-HO1 and the Universal Primer Mix (UPM ...
-
bioRxiv - Plant Biology 2020Quote: ... 5’ and 3’ RACE (rapid amplification of cDNA ends) were performed using the manufacturer’s instructions (Clontech).
-
bioRxiv - Microbiology 2021Quote: ... 5 pmol of probe and 10 μl of Premix Ex Taq (2×) (Takara). Positive amplification controls were DNA purified from ASFV virions at different concentrations used as standards ...
-
bioRxiv - Neuroscience 2024Quote: ... per reaction and 2 µl of 5 µM SMART PCR primer (Takara Bio). Amplification was performed by incubating tubes on a thermocycler at 98°C for 3 minutes followed by 18 cycles of 98°C for 20 seconds ...
-
bioRxiv - Microbiology 2021Quote: The LTR promoter of the HIV-1 laboratory strain pNL4-3 was cloned into the pTA-Luc backbone (Clontech) and is henceforth referred to as pTA-Luc-NL4-3 ...