Labshake search
Citations for Takara Bio :
351 - 400 of 2428 citations for 2 1 ethylpentyl 1 3 dioxan 5 yl laurate since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: ... with the following primers (forward 5’ GAATTCAGATCTATGGTGAGCAAGGGCGAG and reverse 5’ gaattcagatctcttgtacagctcgtccatg) or (forward 5’ GAATTCAGATCTATGGTGAGCAAGGGCGAGGAG and reverse 5’ gaattcagatctcttgtacagctcgtccatgccg) using pEGFP (Clontech) or pCMV-mCherry2 (Clontech ...
-
bioRxiv - Microbiology 2021Quote: ... Transferred RNA was UV-crosslinked to membrane and hybridized with [γ- 32P] 5’-end labeled RFP-spacer specific probe (RFP_crRNA_probe, Supplementary Table 2) in ExpressHyb solution (Clontech Laboratories, Inc) according to manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2024Quote: ... were enriched from the lysate by immunoprecipitation using GFP-Trap (Lablead, GNM-25-1000) and were partially digested by micrococcal nuclease (2 × 10−5 U/μL, Takara, 2910A). The digested RNA was ligated to the 3′-RNA adaptor labeled by biotin ...
-
bioRxiv - Molecular Biology 2022Quote: ... the transfection medium was replaced with 2 ml of reduced serum culture medium (5% FCS) supplemented with 300 μM A/C heterodimerization agent (formerly AP21967, Takara BioInc), 20 mM HEPES and 10 μM cholesterol (balanced with methyl-β-cyclodextrin ...
-
bioRxiv - Cell Biology 2020Quote: ... mouse anti-GFP (for immunohistochemistry 1:1000, Molecular Probes; for Western blotting: 1:10000, Clontech), mouse anti-Tubulin (1:80 ...
-
bioRxiv - Neuroscience 2020Quote: ... Single labeling involved exposure of sections to 1:25,000 or 1:100,000 anti-DSRed (Takara), 1:500 anti-rabbit IgG ...
-
bioRxiv - Microbiology 2021Quote: Antibody sequencing was performed as previously described (Simonich et al., 2019; Vigdorovich et al., 2016) using the SMARTer RACE 5’/3’ Kit (Takara Bio USA Inc., Mountainview, CA). Briefly ...
-
bioRxiv - Cell Biology 2024Quote: ... cells were transfected with siRNA-NPM1 39 or siRNA-HA (5’-CGC UUA UCC UUA UGA CGU A [dT] [dT]-3’) using the Xfect™ RNA transfection reagent (Takara Bio Inc., Shiga, Japan) following the manufacturer’s standard instructions ...
-
bioRxiv - Neuroscience 2022Quote: ... Immunofluorescent staining was performed using primary antibodies (FOS, #2250, Cell Signaling Technology, 1:1000; GFP, GFP1020, Aves Laboratories, 1:1000; dsRed, 632496, Takara, 1:1000), antibodies were reacted with species-specific Alexa Fluor-488 ...
-
bioRxiv - Neuroscience 2021Quote: ... Primary antibodies: anti-GFP (chick 1:20) and anti-DsRed (rabbit, 1:50, Takara Bio#632496). Secondary antibodies ...
-
bioRxiv - Genetics 2024Quote: ... Aliquots of these samples were diluted 1:10 and 1:100 on two plates (Takara Bio): (1 ...
-
bioRxiv - Genetics 2024Quote: ... Aliquots of these samples were diluted 1:10 and 1:100 on three plates (Takara Bio): (1 ...
-
bioRxiv - Neuroscience 2022Quote: ... 3 × 106 HEK293T cells (Clontech) were seeded on a 10 cm cell culture dish and transfected after 24 h with GenJet transfection reagent (SignaGen) ...
-
bioRxiv - Microbiology 2023Quote: ... Shield1: 1.5-3 µM (Takara). With the exception of time-course experiments ...
-
bioRxiv - Bioengineering 2024Quote: ... to a final concentration of 5 µg/mL and 2 µg/mL doxycycline (631311, Takara Bio USA, Inc., Mountain View, CA, USA) for the first 7 days after seeding ...
-
bioRxiv - Neuroscience 2021Quote: ... rabbit anti-dsred (1/1000; TaKaRa), mouse anti-acetylated Tubulin (1/500 ...
-
bioRxiv - Neuroscience 2022Quote: ... rabbit anti-DsRed (1:100, Clontech).
-
bioRxiv - Physiology 2021Quote: ... and DSRed (1:1000, #632392, Clontech) antibodies ...
-
bioRxiv - Molecular Biology 2021Quote: ... 1 U/μl RNase inhibitors (TaKaRa)) ...
-
bioRxiv - Biochemistry 2021Quote: ... anti-mCherry (632543, Takara, 1:1,000), anti-SUMO2/3 (ab3742 ...
-
bioRxiv - Cell Biology 2021Quote: α-His primary antibody (1/10,000; Clontech) and HRP-conjugated goat anti-mouse IgG (H+L ...
-
bioRxiv - Neuroscience 2020Quote: ... GFP (1:1000, Clontech/Takara, #632380). Secondary antibodies were HRP-conjugated and bands were visualized by the ECL Western Blotting Detection Reagent (GE Healthcare ...
-
bioRxiv - Neuroscience 2020Quote: ... GFP (1:1000, Clontech/Takara, #632380). Secondary antibodies were HRP-conjugated and bands were visualized by the ECL Western Blotting Detection Reagent (GE Healthcare ...
-
bioRxiv - Developmental Biology 2021Quote: ... anti-DsRed (1/500, 632496, Clontech), anti-cleaved caspase-3 (1/500 ...
-
bioRxiv - Microbiology 2021Quote: ... 1× ExTaq PCR buffer (Takara, Clontech Laboratories ...
-
Programmed ER fragmentation drives selective ER inheritance and degradation in budding yeast meiosisbioRxiv - Cell Biology 2021Quote: ... anti-GFP JL8 (Clontech, 1:2000), anti-V5 (Invitrogen ...
-
bioRxiv - Neuroscience 2022Quote: ... rabbit anti-Dsred (1:200)(Takara), mouse anti-Lacz (1:200)(Promega) ...
-
bioRxiv - Developmental Biology 2022Quote: ... 1 mM dNTPs (Takara Bio, #639125), 4 mM MgCl2 ...
-
bioRxiv - Immunology 2022Quote: ... Shield-1 was obtained from Clontech and was used at a final concentration of 2.5 μM.
-
bioRxiv - Neuroscience 2020Quote: ... DsRed (rabbit; 1:500, 632496 Takara), TH (mouse ...
-
bioRxiv - Neuroscience 2021Quote: ... anti-DsRed (Clontech, rabbit 1:500), anti-PV (Sigma PARV-19 ...
-
bioRxiv - Cell Biology 2021Quote: ... ZsProSensor-1 (Takara Bio, Tokyo, Japan). This reporter consists of a green fluorescent protein ...
-
bioRxiv - Neuroscience 2021Quote: ... 1:2000 ds-red (Takara Bio). Sections were then washed 3 × 10 min in PBS-T ...
-
bioRxiv - Neuroscience 2021Quote: ... rabbit anti-dsRed (Clontech, 1:1000), goat anti-HRP-Cy5 (Dianova ...
-
bioRxiv - Cancer Biology 2021Quote: ... Shield-1 (Takara Bio USA, Inc), Aqua-Shield-1 (AS1 ...
-
bioRxiv - Neuroscience 2020Quote: ... rabbit anti-DsRed (Clontech, 1:1000), or mouse anti-brp (nc82 ...
-
bioRxiv - Cell Biology 2020Quote: ... His (Takara/Clontech 631212, 1:1000), GFP (Roche 11814460001 ...
-
bioRxiv - Cell Biology 2020Quote: ... His (Takara/Clontech 631212, 1:1000), GFP (Roche 11814460001 ...
-
bioRxiv - Neuroscience 2020Quote: ... 1 U RNAse inhibitor (Takara, 2313A) and 1M betaine (Sigma-Aldrich ...
-
bioRxiv - Developmental Biology 2020Quote: ... rabbit-α-DsRed (1:1000, Clontech), goat-DsRed (1:1000 ...
-
bioRxiv - Developmental Biology 2020Quote: ... anti-dsRed (Clontech #632496, 1:300), anti-c-Myc (Santa Cruz #SC40 ...
-
bioRxiv - Physiology 2020Quote: ... rabbit anti-dsRed 1:250 (Clontech), Cy-3 anti-rabbit 1:400 (Millipore) ...
-
bioRxiv - Developmental Biology 2021Quote: ... rabbit anti-dsRed (1:400, Clontech), and mouse anti-GFP (1:200 ...
-
bioRxiv - Neuroscience 2023Quote: ... anti-Crx (rabbit; 1:200; Takara), anti-Recoverin (rabbit ...
-
bioRxiv - Bioengineering 2022Quote: ... rabbit dsRed (1:250, Takara, 632496), and DAPI ...
-
bioRxiv - Cancer Biology 2023Quote: ... For STEM121 (1:5000, Takara, #Y40410) and Ki67 (1:100 ...
-
bioRxiv - Cell Biology 2023Quote: ... 1 μg/ml of puromycin (Takara) was added to the medium only for two days.
-
bioRxiv - Genomics 2023Quote: ... 1 Unit ExTaq (Takara, catalog #RR001A), 0.2 µM primer 1 ...
-
bioRxiv - Developmental Biology 2023Quote: ... 1 μg/ml Doxycycline (Dox) (Clontech) was added into PGC-cultured FAcs medium 24 hours before the injection ...
-
bioRxiv - Molecular Biology 2023Quote: ... His6 (631212, Clontech, mouse, 1:500); NPL4 (sc-365796 ...