Labshake search
Citations for Takara Bio :
1351 - 1400 of 2806 citations for 6 methyl 4 oxo N phenyl 2 3 dihydro 1 4 oxathiine 5 carboxamide since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2024Quote: ... 1:500 (Clontech, 632496); Mouse Anti-GFP-4C9 ...
-
bioRxiv - Biochemistry 2021Quote: ... A total of 5 μg of RNA were reverse transcribed and amplified using One Step SYBR Prime-Script PLUS RT-PCR Kit (TaKaRa) and the Thermal Cycler Dice instrument (TaKaRa ...
-
bioRxiv - Neuroscience 2020Quote: ... cDNA was pre-amplified by adding 2 uL of cDNA from each sample to 8 uL of preamp master mix [5 uL TaKaRa premix Taq polymerase (Clontech), 2.5 uL 0.2X Taqman pooled probe ...
-
bioRxiv - Genomics 2020Quote: ... The resulting plasmids were digested with Kpn1 and Xho1 at the multiple cloning site of the vector and serially deleted from the XhoI cutting site (5’-protruding end) by treating the plasmids with exonuclease III and mung bean nuclease (Takara) for fixed times ...
-
Potential for virus endogenization in humans through testicular germ cell infection: the case of HIVbioRxiv - Microbiology 2020Quote: ... or pBR_NL4-3 92TH014.12 IRES eGFP (R5 tropic) [81] (a kind gift from Frank Kirchhoff, Ulm University, Germany) and VSV-G envelope encoding plasmid (PT3343-5, Clontech). 293T cell supernatants were collected 3 days post-transfection ...
-
bioRxiv - Biochemistry 2022Quote: ... The precipitated material was removed by centrifugation and the soluble fraction was loaded onto a column (5 mL) containing Talon affinity resin (Clontech) equilibrated in buffer A ...
-
bioRxiv - Cancer Biology 2022Quote: ... 5 million cells were electroporated with 5 µg of plasmids encoding tested lncRNAs or with of the pEGFP-N3 reporter vector (Clontech) as previously described 30 ...
-
bioRxiv - Microbiology 2022Quote: Sequence of the human variable heavy and kappa chains were obtained by using SMARTer 5’ RACE technology (Takara Bio USA) adapted for antibodies to amplify the variable genes from heavy and kappa chains for each hybridoma ...
-
bioRxiv - Molecular Biology 2022Quote: ... and the RNA was concentrated and reverse transcribed with a 5’-RACE protocol that appends a new primer site to the cDNA of both cleaved and uncleaved RNA (SMARTScribe, Takara). The cDNA was PCR amplified with primers that add the adaptors for Illumina sequencing ...
-
bioRxiv - Molecular Biology 2022Quote: Rps29 5’UTR and coding region cDNAs were synthesised using SMART™ RACE cDNA Amplification Kit (Clontech Laboratories Inc. USA). PCR was performed using gene-specific primers (40S 5’ RACE R ...
-
bioRxiv - Immunology 2022Quote: ... 25 μg of the retroviral expression vector (pLZRS-human codon-optimized Bcl6-P2A-human codon-optimized BclxL-IRES-GFP) and 5 μg of the envelope vector (p10A1; Clontech) were transfected into GP2-293 cells using Lipofectamine 3000 (ThermoFisher ...
-
bioRxiv - Microbiology 2019Quote: ... All ∼5 kb products were amplified from bat genomic DNA by inverse PCR employing the PrimeSTAR MAX DNA polymerase (Takara), purified by gel extraction (Axygen) ...
-
bioRxiv - Immunology 2020Quote: ... for 24 h and transduced with lentiviral particles by spinfection (1000 x g for 90 min at 32°C) in the presence of Polybrene (5 μg/ml) on the plates coated with Retronectin (50 μg/ml) (Takara/Clontech) and anti-CD3 (1–2 μg/ml) ...
-
bioRxiv - Molecular Biology 2021Quote: ... was then added to the supernatant to a final concentration of 5 mM and the solution was subjected to immobilized metal affinity chromatography (IMAC) by incubation with TALON cobalt resin (Takara) for 1 hr at 4°C ...
-
bioRxiv - Neuroscience 2021Quote: ... AP-MDGA1 and AP-MDGA2 were generated by replacing the V5 tag of the V5-MDGA1 and V5-MDGA2 constructs respectively by the 14 amino acids AP tag (5’GGCCTGAACGAtATCTTCGAGGCCCAG AAGATCGAGTGGCACGAG3’) using the HD-In-Fusion kit (Takara). The linker 5’GGAGGATCAGGAGGATCA3’ was added after the AP tag ...
-
bioRxiv - Biophysics 2020Quote: ... containing either tetra-acetylated or unmodified histone H4 was digested for 5 min at 22 °C with micrococcal nuclease (MNase) (0.125 to 2.0 units; Takara, cat. #2910A) in 5.5 mM Tris-HCl buffer (pH 7.6 ...
-
bioRxiv - Genetics 2021Quote: ... The fragment length of PCR products was detected by 1.2% agarose gel electrophoresis using 5 μl of 100 bp DNA Ladder (TaKaRa, Japan) and gel stain (TransGen Biotech ...
-
bioRxiv - Cancer Biology 2022Quote: ... PCR purified integrin β5 with engineered flanking restriction sites (Xho-I/BamHI) was subcloned into the multi-cloning sites of pEGFP-N1 (Clontech) to encode an in-frame fusion protein with the carboxy-terminal EGFP-tag (pEGFP-N1-Integrin β5 ...
-
bioRxiv - Genomics 2022Quote: Genomic DNA samples (5 ng) were used as templates in 20 μl reactions performed with PrimeSTAR GXL DNA Polymerase (TaKaRa), according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2022Quote: ... Transferred membranes were blocked with 5% (w/v) milk for 30 mins at RT before being hybridized with the corresponding anti-GFP (632381, Takara) or anti-mCherry (632543 ...
-
bioRxiv - Immunology 2022Quote: ... Lentiviral transduction of murine alveolar macrophages was performed for 7 days in the presence of 5 μg/cm2 RetroNectin (Takara). Stable gene expression was confirmed by GFP signals using a BZ-X710 (KEYENCE ...
-
bioRxiv - Molecular Biology 2022Quote: ... the NaCl concentration of the cleared lysate was adjusted to 500 mM and the cleared lysate was applied to 10 mL (=5 mL bed volume) equilibrated Talon SuperFlow Metal Affinity Resin (TaKaRa) per L culture on ice for 45 min ...
-
bioRxiv - Bioengineering 2022Quote: ... The solution was heated at 65°C for 5 minutes using Takara® PCR Thermal Cycler (Takara Corp., Shiga, Japan), and then gradually cooled down to 30°C over a time span of 10 minutes before settling down to 4 °C ...
-
bioRxiv - Molecular Biology 2022Quote: ... Libraries for RNA sequencing were prepared from 5 ng RNA/sample using the SMARTer Stranded Total RNA-Seq Kit v2 -Pico Input Mammalian (Takara) according to the manufacturer’s instructions using 12 PCR cycles for amplification ...
-
bioRxiv - Microbiology 2023Quote: Sequence of the mouse variable heavy and kappa chains were obtained by using SMARTer 5’ RACE technology (Takara Bio, USA) adapted for antibodies to amplify the variable genes from heavy and kappa chains for each hybridoma based on isotype ...
-
bioRxiv - Plant Biology 2024Quote: Rapid amplification of cDNA ends (5’ RACE) was used to determine the transcripts of the RB gene using the SMARTer RACE cDNA Amplification Kit (Clontech) according to the protocol ...
-
bioRxiv - Microbiology 2023Quote: ... iBMDMs were seeded into 24-well plates (5×104 cells/well) and transfected with 600 ng and 1200 ng of the eukaryotic expression vector (pCMV-HA; Clontech) harbouring TcpB for 24-hours ...
-
bioRxiv - Cell Biology 2023Quote: ... Up to 5 μl of assembly reactions were used for heat-shock transformation of Stellar™ Competent Cells (Takara Bio).
-
Induction of PARP7 Creates a Vulnerability for Growth Inhibition by RBN2397 in Prostate Cancer CellsbioRxiv - Cancer Biology 2023Quote: ... BBQ and FICZ as indicated at 37°C in 96-well plates for 5 days prior to measuring viability using WST reagent (Takara) following the manufacturer’s protocol ...
-
bioRxiv - Immunology 2023Quote: ... RNA-seq libraries were generated from 5 ng of RNA with the SMART-Seq v4 Ultra Low Input RNA Kit from Takara Bio (#634889 ...
-
bioRxiv - Plant Biology 2023Quote: ... diluted to 1 µg/mL with Milli-Q ultra-pure water for 5 min at room temperature or with a pollen germination medium containing 2000-fold SYBR Green I (Cat#: 5760A, Takara) and 5 µg/mL DAPI (Cat# 10236276001 ...
-
bioRxiv - Cell Biology 2023Quote: ... The DNA fragment coding GFP was inserted at the 5’ side of SYP32 by In-Fusion HD Cloning Kit (Takara), and the whole sequence was recombined into pGWB1 by LR Clonase II ...
-
bioRxiv - Molecular Biology 2024Quote: ... was amplified from 0.5 µl (5 ng) of a gene fragment in 20 µl using 2X CloneAmp HiFi PCR Premix (Takara Bio) with 250 nM of each primer TAATACGACTCACTATAGGCAATCCGCCCTCACTACAACCG and TCCCTCATCGACGCCAGAGTAG ...
-
bioRxiv - Immunology 2024Quote: ... total RNA (0.5 ng) was added to reaction buffer from the SMART-Seq v4 Ultra Low Input RNA Kit for Sequencing (Takara), and reverse transcription was performed followed by PCR amplification to generate full length amplified cDNA ...
-
bioRxiv - Cell Biology 2023Quote: ... Expression level of Venus and Venus-tagged arrestin-3 proteins was determined with anti-GFP JL-8 antibody (#632381, Takara Bio USA, San Jose, CA). The endogenous β-actin (loading control ...
-
bioRxiv - Cell Biology 2020Quote: ... SLD3 and ESA1 ORF were PCR-amplified with Taq polymerase (MightyAmp ver. 2, Takara Bio Co., Otsu, Japan) and cloned into the BamHI sites of the Y2H DB vector pST1667 and the Y2H AD vector pST548 (Tanaka ...
-
bioRxiv - Cell Biology 2020Quote: ... transformed with pGEX-4T-2-Bbs5-WT in the presence of 0.1 mM isopropyl-β-D-thiogalactopyranoside (Takara). The proteins were purified with the glutathione-Sepharose 4B protein chromatography purification kit (GE Healthcare) ...
-
bioRxiv - Genomics 2019Quote: ... Long range PCR was performed using Advantage 2 Polymerase following the manufacturer’s protocol (Clontech Laboratories, Mountatin View CA).
-
bioRxiv - Cancer Biology 2020Quote: Freshly harvested sorted LT-HSCs were starved in PBS for 2 hours and then fixed onto RetroNectin (Clontech)-coated slides ...
-
bioRxiv - Microbiology 2021Quote: ... 10 μg of Spike expressor and 2 μg of a green fluorescent protein (GFP) expressor (pIRES2-eGFP; Clontech) was transfected into 2 × 106 293T cells ...
-
bioRxiv - Neuroscience 2020Quote: ... cell content was ejected onto 1.1 µl drop of lysis buffer (0.1% Triton X-100, 2 U/µl TaKaRa RNAse inhibitor ...
-
bioRxiv - Cell Biology 2021Quote: ... 2 µg of total RNA was subsequently reverse transcribed to cDNA using PrimeScript RT Master Mix (Takara Bio) according to the manufacturer’s protocol ...
-
bioRxiv - Physiology 2022Quote: ... cDNA was synthesized using 2 μg RNA using the PrimeScript™ RT reagent Kit with gDNA Eraser (TaKaRa). Gene specific primers for quantitative real-time PCR (qRT-PCR ...
-
bioRxiv - Plant Biology 2021Quote: ... 2 μg of RNA was reverse transcribed in a 20 μL volume with RT PCR master mix (TaKaRa) as per the manual instruction ...
-
bioRxiv - Microbiology 2020Quote: ... RT-qPCR was then performed using gene-specific primers (Table 2) and TB Green Premix Ex Taq (Takara). Levels of gene expression were normalized to that of 16S rRNA and expression was assessed for each biofilm and each timepoint relative to its planktonic counterpart using the 2−ΔΔCt method (43).
-
bioRxiv - Evolutionary Biology 2022Quote: ... Yeast 2-hybrid library screening was conducted using the Matchmaker Gold Yeast Two-Hybrid System (Takara Bio USA) according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2022Quote: Purified total RNA was reverse transcribed into cDNA by PrimeScript™ 2 1st strand cDNA Synthesis Kit (TaKaRa). The target gene fragments (Brachyury ...
-
bioRxiv - Systems Biology 2019Quote: ... the samples were added to 2 μL of second-strand synthesis mix (2.5× NEB buffer 2 [New England Biolabs], 0.625 mM each dNTP Mixture [TaKaRa] ...
-
bioRxiv - Microbiology 2020Quote: ... The qPCR reaction system consisted of 12.5 μL of 2 × SYBR Premix Ex TaqTM II (Takara, Dalian, China), 0.5 μL of upstream and downstream primers (10 mM) ...
-
bioRxiv - Plant Biology 2021Quote: ... URA3: GAL1UAS–Gal1TATA–LacZ MEL1) via the Yeastmaker™ Yeast Transformation System 2 kit (Clontech, Mountain View, USA). An agarose gel image of the cDNA library is shown in Fig ...