Labshake search
Citations for Takara Bio :
1251 - 1300 of 2806 citations for 6 methyl 4 oxo N phenyl 2 3 dihydro 1 4 oxathiine 5 carboxamide since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2020Quote: ... three replicate wells of 5□×□104 cells per well were seeded in a retronectin (Takara Bio Inc, JPY) coated 24-well XF24 plate ...
-
bioRxiv - Immunology 2022Quote: ... IGK and IGL 5’RACE AIRR-seq libraries were generated using the SMARTer Mouse BCR Profiling Kit (Takara Bio ...
-
bioRxiv - Biochemistry 2020Quote: ... The supernatant was supplemented with 5 mM imidazole pH 8.0 before incubation with Co2+ charged TALON resin (Clontech) for 1 h on a rotator (1 ml resin slurry per L original culture volume) ...
-
A bacterial derived plant- mimicking cytokinin hormone regulates social behaviour in a rice pathogenbioRxiv - Microbiology 2021Quote: ... 5 μg of total RNA was reverse transcribed into cDNA using EcoDryTM Premix (Clontech, Mountain View, CA, USA) according to the manufacturer’s instructions using random hexamer primers ...
-
bioRxiv - Genomics 2022Quote: ... in which 5 pmol of substrate primer and 12,5 µl of TB Green Premix Ex Taq II (Takara) were added ...
-
bioRxiv - Cancer Biology 2022Quote: CPT1a knockdown cell lines were generated using the shRNA-expressing lentiviral pLKO-shRNA2 vector (No. PT4052-5; Clontech), with a puromycin selection cassette ...
-
bioRxiv - Cell Biology 2023Quote: ... and used for library preparation (5-10 ng) using SMART-Seq v4 Ultra Low Input RNA Kit (Clontech). Libraries were sequenced on Novaseq platform (Illumina).
-
bioRxiv - Bioengineering 2023Quote: ... T cells were mixed with lentivirus at multiplicity of infection (MOI) equal to 5 in Retronectin (Takara, T100B)-coated culture plates and centrifuged at 1800 g for 1 h at 32 °C for lentiviral transduction before returning to normal culture condition ...
-
bioRxiv - Molecular Biology 2024Quote: ... 5 µL of the eluate was digested overnight at 37°C with 10 units of DpnI (Takara, 1235A) in a final volume of 10 µL ...
-
bioRxiv - Cancer Biology 2024Quote: ... T cells were transduced using lentivirus at an MOI between 5 and 10 on Retronectin-coated (Takara, T100B) plates overnight to express an M5 or SS1 CAR ...
-
bioRxiv - Cancer Biology 2021Quote: ... containing 2 μL of PBS including 0.2% Triton X-100 and 4U of RNase inhibitor (Takara) per well ...
-
bioRxiv - Cancer Biology 2021Quote: Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix (Clontech) and the SINGV6 primer (10 pmol ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Membranes were baked for 2 h at 80°C and prehybridized in ExpressHyb (Clontech, Mountain View) at 65°C for 1h ...
-
bioRxiv - Cell Biology 2021Quote: ... and reverse transcription of 2 μg of RNA was performed using PrimeScript RT Master Mix (TaKaRa). RT-qPCR was performed with SYBR Premix Ex Taq ((Tli RNaseH Plus) ...
-
bioRxiv - Plant Biology 2021Quote: ... Co-transformants were selected by cultivation for 2 days on minimal synthetic defined (SD) media (Clontech) lacking Leu (pACT2-GW ...
-
bioRxiv - Microbiology 2022Quote: ... Total RNA (2 μg) was used for reverse transcription with the PrimeScriptTM RT reagent Kit (TaKaRa). Quantitative expression assays were performed by using the 2x M5 HiPer SYBR Premix EsTag kit (Mei5bio ...
-
bioRxiv - Microbiology 2021Quote: ... two to four overlapping DNA fragments were PCR amplified (Advantage HF 2 PCR Kit from Clontech) using primers described Table S4 ...
-
bioRxiv - Molecular Biology 2021Quote: Primers were designed using the Takara Bio Perfect Real Time Support System (Takara Bio, Table 2). Primers were diluted to 50 µM in ddH20 and stored at -20°C ...
-
bioRxiv - Physiology 2021Quote: ... Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix (Clontech) and the SINGV6 primer (10 pmol ...
-
bioRxiv - Immunology 2020Quote: ... PCR samples were indexed with Nextera Illumina Indices reads using the Advantage 2 PCR kit (Clontech) in a 8 PCR cycle reaction and purified with Agencourt AMPpure XP beads (Beckman Coulter ...
-
bioRxiv - Immunology 2021Quote: ... AAV6 vector genomes were titrated by ITR-specific quantitative PCR (Takara AAVpro Titration Kit Ver.2) per the manufacturer’s protocol.
-
bioRxiv - Molecular Biology 2022Quote: ... Yeast transformation was performed according to the Yeastmaker Yeast Transformation System 2 User Manual (Clontech, Japan). The primers used are listed in Supplemental Table S1.
-
bioRxiv - Immunology 2022Quote: ... SARS-CoV-2 RBDs were purified using a Cobalt affinity column (HisTALON Superflow column from Takara or HiTrap TALON crude column from Cytiva ...
-
bioRxiv - Microbiology 2024Quote: ... UMI-tagged spike gene cDNA was amplified using the Advantage 2 PCR kit (Takara Bio, 639206) with forward primer TTCGCATGGTGGACAGCCTTTGTT and reverse primer CCGCTCCGTCCGACGACTCACTATA under the following thermocycling conditions ...
-
bioRxiv - Cancer Biology 2024Quote: ... 2 μg of genomic DNA was used as a template using Titanium Taq PCR kit (Takara). The sequence information for the primers used for barcode amplification was kindly provided by Novartis and can be found in Supplementary Table 4 ...
-
bioRxiv - Immunology 2022Quote: ... and treated with Exonuclease I (New EnglandBiolabs) before amplification by the Advantage 2 PCR kit (Clontech) and the SINGV6 primer (95°C for 1 min ...
-
bioRxiv - Biochemistry 2023Quote: ... LayV G was purified from clarified supernatants using 2 mL of cobalt resin (Takara Bio TALON), washing with 200 column volumes of 50 mM Tris-HCl pH 8.0 ...
-
bioRxiv - Developmental Biology 2023Quote: Yeast two-hybrid assays were performed according to the Yeastmaker Yeast Transformation System 2 manual (Clontech). The yeast strain AH109 was co- transformed with an AD-fused and a BD-fused construct using the lithium acetate method ...
-
bioRxiv - Cancer Biology 2023Quote: ... 2 μg of RNA was converted to cDNA using PrimeScript 1st Strand cDNA Synthesis Kit (TaKaRa) in SureCycler 8800 (Agilent Technologies) ...
-
bioRxiv - Cell Biology 2023Quote: ... Second strand synthesis and PCR amplification was performed by adding the Advantage 2 Polymerase Mix (Clontech) and the SINGV6 primer (10 pmol ...
-
bioRxiv - Molecular Biology 2023Quote: ... or 100 ng of genomic DNA was amplified with Advantage GC 2 polymerase (Takara Bio 639114) using 1 M GC Melt and primers spanning the region from upstream of the splice donors to the 3’ end of the repeat ...
-
bioRxiv - Plant Biology 2024Quote: ... First-strand cDNA was synthesized using 2 μg RNA and PrimeScript RT Master Mix (Takara Bio). qRT-PCR was performed using the first-strand cDNAs diluted 5-fold in water and KAPA SYBR FAST qPCR Master Mix (2x ...
-
bioRxiv - Cancer Biology 2024Quote: ... Viral supernatant was collected 2 days post-transfection and concentrated using Lenti-X lentivirus concentrator (Clontech). Cells were then infected with the concentrated lentivirus ...
-
bioRxiv - Cancer Biology 2020Quote: ... Amplified cDNA from the ICELL8® 3’ DE Chip individual cells was collected and pooled using the ICELL8® Collection Kit (Takara Bio) by centrifugation at 3,200 x g ...
-
bioRxiv - Microbiology 2020Quote: pEX18Tc-hpdA was constructed for gene knockout by fusing the erythromycin resistance gene and two upstream and downstream fragments of the target gene amplified with the primers shown in Table 3 to Sac I/Hind III-digested pEX18Tc with the In-Fusion® HD Cloning Kit (TaKaRa, Dalian, China). The resulting plasmid pEX18Tc-hpdA was transformed into E ...
-
bioRxiv - Microbiology 2019Quote: ... reverse transcription of the RNA using a primer designed to the constant region of the barcoded adaptor with addition of an adapter to the 3’ end of the cDNA by template switching using SMARTScribe (Clontech, Mountain View, C.A.) as described (44) ...
-
bioRxiv - Microbiology 2023Quote: ... or the BamHI/MluI site of pWPI-ACE2-zeo (for ACE2 expression plasmids)43 with 3×FLAG-tag at the C-terminus using In-Fusion® HD Cloning Kit (Takara, Cat# Z9650N). Nucleotide sequences were determined by DNA sequencing services (Eurofins) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Transfected cells were cultured for over 3 weeks in complete RPMI-1640 medium containing G418 (600 μg/ml; Clontech, Palo Alto, CA, USA) to select resistant clones.
-
bioRxiv - Neuroscience 2023Quote: ... Media containing lentiviral particles was collected 72 hours post-transfection and the lentiviral particles were precipitated with 3 volumes of Lenti-X Concentrator (Takara, cat. no. 631232) at 4°C overnight ...
-
bioRxiv - Plant Biology 2023Quote: ... the genomic sequence from the MpRKD promoter region (3827 bp upstream from start codon) to the 3’UTR was amplified by PCR with PrimeSTAR HS DNA polymerase (TaKaRa Bio, Kusatsu, Japan) and the primers IF-Hind-pRKD-F and IF-Sal-gRKD-R ...
-
bioRxiv - Molecular Biology 2021Quote: ... and 1 µM of Shield-1 peptide (Clontech, Mountain View CA) for 4-6 hours ...
-
bioRxiv - Molecular Biology 2024Quote: - IgG detector solution V2 (1:2000 dilution, Takara, Cat# T7122A-1).
-
bioRxiv - Molecular Biology 2024Quote: IgG detector solution V2 (1:2000 dilution, Takara, Cat# T7122A-1).
-
bioRxiv - Molecular Biology 2023Quote: ... and 1 μM of Shield-1 peptide (Clontech, Mountain View CA) for 4 h ...
-
bioRxiv - Developmental Biology 2020Quote: ... and mCherry were isolated by PCR from various templates and inserted into the pGL4.23-(C120×5)-TATA vector with In-Fusion cloning (Clontech) according to manufacturer instructions using a 1:2 vector-to-insert ratio to generate optogenetic response plasmids ...
-
bioRxiv - Molecular Biology 2019Quote: ... The PCR reaction mixture (10 μl total volume) included 5 μl SYBR Premix Ex Taq II (TaKaRa, Dalian, China), 3.5 μl ddH2O ...
-
bioRxiv - Microbiology 2022Quote: ... The 5’ end regions of MIC14 and MIC15 were amplified using the SMART RACE cDNA Amplification Kit (Clontech BD) using total or poly(A)+tachyzoite RNA (strain RH ...
-
bioRxiv - Molecular Biology 2022Quote: ... bound RNAs were eluted via 30min incubation at 55°C in wash buffer supplemented with 0.5 μg/μL Proteinase K and 0.1% SDS and isolated using Qiazol/chloroform separation and NucleoSpin RNA columns (Takara). Luciferase control RNA is spiked in to each sample (5ng/sample ...
-
bioRxiv - Cell Biology 2019Quote: pLL6-MYH12A construct was made by replacing 5’LTR promoter in pLL5.0 (Cai et al., 2008) with PTight promoter from pTRE-Tight Vector (Clontech) and inserting human MYH12A using EcoRI-BamHI cloning sites ...
-
bioRxiv - Biochemistry 2021Quote: ... prepared as described above was mixed with imidazole (5 mM) and 0.5 mL of Talon superflow metal affinity resin (Clontech) that had been equilibrated with buffer (as above for magnetic agarose) ...