Labshake search
Citations for Takara Bio :
1301 - 1350 of 4926 citations for Human Alpha ketoglutarate dependent dioxygenase FTO FTO ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2020Quote: ... AGAAACGGAACTCCAGAAGACC) was performed using the SYBR Green Prime Script kit (RR420A, TAKARA). GAPDH (GAPDH F ...
-
bioRxiv - Cancer Biology 2021Quote: ... Protein concentration was measured using the BCA Protein Assay Kit (Takara Bio). The protein samples were subjected to SDS-polyacrylamide gel electrophoresis and transferred to polyvinylidene fluoride membranes using the Trans-Blot Turbo Transfer System (Bio-Rad) ...
-
bioRxiv - Biochemistry 2021Quote: ... cDNA synthesis was performed using the PrimeScript™ RT reagent Kit (Takara) following purchaser’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... RT-qPCR was performed using One-Step PrimeScript RT-PCR Kit (Takara).
-
bioRxiv - Cancer Biology 2020Quote: ... Total RNA (1μg) was reverse transcribed with PrimeScript RT Reagent Kit (Takara). Quantitative real-time PCR was performed using the Light Cycler 1.5 (Roche ...
-
bioRxiv - Cancer Biology 2021Quote: ... cDNA was synthesized from RNA using SMARTer PCR cDNA synthesis kit (Clontech) per manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2021Quote: ... RNAseq libraries were subsequently prepared using the SMART-Seq Stranded Kit (Takara) according to the manufacturer’s instruction ...
-
bioRxiv - Pathology 2021Quote: ... and the Quant-X One-Step qRT-PCR TB Green Kit (Takara). A Lenti-X RNA Control Template was provided by the kit and served to build a standard curve of viral genome copies ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... by using One Step TB Green PrimeScript PLUS RT-PCR Kit (Takara) and host RNA-specific primers (Supplementary Table S3) ...
-
bioRxiv - Microbiology 2021Quote: ... cDNA was synthesized using the RT reagent kit with gDNA eraser (Takara). qRT-PCR was performed using SYBR Premix ExTaq (TaKaRa ...
-
bioRxiv - Genetics 2021Quote: ... cDNA synthesis was done by SMART-Seq Single Cell kit (Takara Bio) and the library was prepared with Nextera XT DNA library preparation kit (Illumina) ...
-
bioRxiv - Molecular Biology 2021Quote: ... HEK293T cells were transfected using the CalPhos mammalian transfection kit (TaKaRa Clontech) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... using the SYBR® PrimeScript™ RT-PCR Kit (Takara, Dalian, China).
-
bioRxiv - Microbiology 2020Quote: ... per the manufacturer’s instructions for PrimeScript™ miRNA RT-PCR Kit (Takara). The PCR mixture contained 3 μl cDNA ...
-
bioRxiv - Immunology 2021Quote: ... Lentivirus was titrated using the Lenti-XTM p24 Rapid Titer Kit (Takara) according to the manufacturer’s instructions.
-
bioRxiv - Microbiology 2021Quote: ... Reverse transcription was carried out using PrimeScript™RT reagent Kit (Takara) using random hexamers and PCR was performed with PrimeSTAR Max DNA Polymerase (Takara) ...
-
bioRxiv - Molecular Biology 2021Quote: ... and a luminometric β-galactosidase detection kit (Takara Bio, Palo Alto, CA) following the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2021Quote: ... Mutations were introduced using PrimeSTAR mutagenesis basal kit (Takara Bio, cat# R046A), according to the manufacturers’ instruction ...
-
bioRxiv - Molecular Biology 2021Quote: Sequencing libraries were prepared using SMARTer Stranded RNA-seq kit (Clontech #634837) according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2020Quote: ... AAVPro Purification Kit (All Serotypes)(Takara Bio USA, Mountain View, CA, USA) were also used following the 48-72 h incubation period ...
-
bioRxiv - Immunology 2020Quote: ... cDNA was generated via the Smarter 5’RACE cDNA amplification kit (Clontech) using 4.5μl mRNA input and following the recommended protocol ...
-
bioRxiv - Immunology 2020Quote: ... Libraries were prepared using the SMARTseq Stranded Total RNA kit (Takara Bio) with ZapR kit (Takara Bio ...
-
bioRxiv - Immunology 2020Quote: ... and sequencing libraries were constructed by using SMARTer cDNA synthesis kits (Takara). Libraries were sequenced by using the HiSeq 2500 platform (Illumina ...
-
bioRxiv - Microbiology 2021Quote: ... With the help of homologous recombinase (In-Fusion HD Cloning Kit, Takara), the two ends of the sequence with homologous arms were connected and verified by Sanger sequencing ...
-
bioRxiv - Immunology 2021Quote: RACE-PCR was performed using the SMARTer 5’/3’ RACE kit (Clontech) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2019Quote: ... 1.2-μM SMARTer Kit SMARTer II A Oligonucleotide (12 μM; Clontech, 634936), 1-U/μL SMARTer Kit RNase Inhibitor (40 U/μL ...
-
bioRxiv - Genomics 2019Quote: ... 1-U/μL SMARTer Kit RNase Inhibitor (40 U/μL; Clontech, 634936), 10-U/μL SMARTScribe™ Reverse Transcriptase (100 U/μL ...
-
bioRxiv - Immunology 2021Quote: ... cDNA was synthesized using PrimeScript™ RT Reagent Kit (TaKaRa, Cat#RR037A), Real-time PCR reactions were performed using TB Green Premix Ex Taq reagent (TaKaRa ...
-
bioRxiv - Molecular Biology 2020Quote: ... The mutants were constructed by conventional PCR using a MutanBEST kit (TaKaRa) and further verified by DNA sequencing ...
-
bioRxiv - Immunology 2021Quote: ... and cDNA was prepared using SMART-seq v4 cDNA synthesis kit (Takara). Sequencing libraries were constructed using 200 pg cDNA as input for the NexteraXT kit with NexteraXT indexing primers (Illumina) ...
-
bioRxiv - Immunology 2022Quote: ChIP-seq libraries were prepared using a ThruPLEX DNA-seq Kit (Clontech) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2022Quote: All cloning was accomplished using the In-Fusion HD cloning kit (Takara). To create the BioID2 fusion constructs ...
-
bioRxiv - Bioengineering 2022Quote: ... Total RNA was isolated using NucleoSpin® RNA kit (Takara/Clontech 740955), followed by cDNA synthesis using High Capacity cDNA Reverse Transcription kit (ThermoFisher 4368814 ...
-
bioRxiv - Bioengineering 2022Quote: ... Total RNA was isolated using NucleoSpin® RNA kit (Takara/Clontech 740955), followed by cDNA synthesis using High Capacity cDNA Reverse Transcription kit (ThermoFisher 4368814 ...
-
bioRxiv - Developmental Biology 2022Quote: ... the cDNA was amplified using a SYBR Premix Ex Taq Kit (TaKaRa) on the CFX96 Touch™ Real-Time System (Bio-Rad) ...
-
bioRxiv - Molecular Biology 2022Quote: ... DNA was purified using the NucleoBond Xtra BAC kit (Takara Bio 740436.25) and stored at 4°Cfor less than one week before delivering to mESCs.
-
bioRxiv - Neuroscience 2022Quote: ... or the SMARTer Stranded Total RNA Kit v2 - Pico Input Mammalian (Takara) according to the manufacturer’s instructions.
-
bioRxiv - Microbiology 2022Quote: ... DNA was extracted using the NucleoSpin kit (Takara Bio, Kusatsu, Shiga, Japan). Sequencing libraries were then prepared from 3 ng of CUT&RUN DNA with the Kapa HyperPrep Kit (Roche ...
-
bioRxiv - Microbiology 2022Quote: ... The protein concentration was determined by a BCA protein assay kit (TakaRa) using bovine serum albumin (BSA ...
-
bioRxiv - Microbiology 2023Quote: ... RNA samples were reverse-transcribed using Prime Script RT Reagent kit (TaKaRa) in combination with an AS1-specific tagged primer (no ...
-
bioRxiv - Plant Biology 2023Quote: Genome walking was conducted using the Universal GenomeWalker 2.0 kit (Takara Bio) according to the manufacturer’s instructions to isolate GdMYBSG6-1 and GdMYBSG6-2 5’UTRs and the promoter regions of GdANS and GdMAT1 ...
-
bioRxiv - Genetics 2022Quote: ... gDNA was extracted using a Nucleospin Blood Maxi kit (Takara, Cat. #740950) (for CRISPR/Cas9 screening ...
-
bioRxiv - Neuroscience 2022Quote: ... the SMART-Seq v4 Ultra Low input RNA kit (Takara Bio USA) was used according to the manufacturer’s instructions ...
-
bioRxiv - Physiology 2022Quote: ... Protein concentration was determined using the BCA protein assay kit (Takara Bio).
-
bioRxiv - Molecular Biology 2022Quote: ... reverse transcriptions were performed using PrimeScriptTM RT reagent kit (TaKaRa, Ohtsu, Japan). RT-qPCR was performed using ChamQ Universal SYBR qPCR Master Mix (Vazyme ...
-
bioRxiv - Immunology 2022Quote: ... All cloning reactions were performed using In-Fusion HD cloning kit (Clontech) in a standard reaction mixture.
-
bioRxiv - Neuroscience 2022Quote: ... The fragments were then assembled using In-Fusion HD cloning kit (Clontech) to obtain the desired chimeric OR ...
-
bioRxiv - Microbiology 2022Quote: ... and cDNA was synthesized with a PrimeScript™ RT Reagent Kit (Takara) following the manufacturer’s protocol ...
-
bioRxiv - Immunology 2022Quote: ... and reverse-transcribed to cDNA using PrimeScript RT reagent kit (TaKaRa Biotechnology). RT-PCR was performed with StepOnePlus (Applied Biosystems ...
-
bioRxiv - Neuroscience 2022Quote: ... cDNA was generated with a PrimeScript RT reagent kit (Takara Cat# RR047A). Quantitative real-time polymerase chain reaction (qRT-PCR ...