Labshake search
Citations for Takara Bio :
1201 - 1250 of 4926 citations for Human Alpha ketoglutarate dependent dioxygenase FTO FTO ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: ... except ligation was performed using a BD In-FusionTM cloning kit (Clontech), according to the manufacturer’s instructions (primers listed in SI Appendix Table S12) ...
-
bioRxiv - Molecular Biology 2020Quote: ... pCLT-mt1 and mt2 were generated by PrimeSTAR Mutagenesis Basal Kit (Takara). pET22b-TruB1 ...
-
bioRxiv - Cell Biology 2020Quote: Purified RNA was transcribed into cDNA using the PrimeScript Reagent Kit (Takara). The volume equivalent of 0.2 µg of RNA was reverse transcribed in a 40 µL reaction volume ...
-
bioRxiv - Genetics 2021Quote: ... and reverse transcription was performed using the PrimeScript RT Reagent Kit (Takara). Equal masses (concentration times volume ...
-
bioRxiv - Genetics 2021Quote: ... Libraries were prepared using SMARTer ThruPLEX DNA-Seq Kit (Takara Bio # R400675)
-
bioRxiv - Genetics 2021Quote: Using the SYBR Premix Ex TaqTM II kit (Takara Biotechnology, Tokyo, Japan) to perform the quantitative real-time PCR assay with CFX ConnectTM Real-Time PCR Detection System (Bio-Rad Laboratories ...
-
bioRxiv - Genetics 2020Quote: ... was generated with the In-Fusion HD Cloning Kit (Clontech Laboratories, Inc.). The pCFD3-dU63gRNA plasmid ...
-
bioRxiv - Microbiology 2021Quote: ... it was reverse transcribed using the PrimeScript™ RT reagent Kit (TaKaRa). The GPC segment was amplified and sequenced using primers ...
-
bioRxiv - Neuroscience 2021Quote: ... The amplified fragment was ligated using the In-Fusion cloning kit (Takara) into the pGL4.13[luc2/SV40] (E6681 ...
-
bioRxiv - Developmental Biology 2021Quote: ... The RNA was reverse-transcribed with PrimeScript™ RT reagent Kit (Takara) and RT-PCR was analyzed with gene specific primers listed in Table S1 ...
-
bioRxiv - Plant Biology 2022Quote: All constructs were obtained with the In-Fusion HD cloning kit (Takara) and sequence verified ...
-
bioRxiv - Molecular Biology 2022Quote: 5’ RACE was performed using SMARTer RACE 5’/3’ Kit (TAKARA #634858) following the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2021Quote: ... RT-qPCR was performed using a First Strand cDNA Synthesis Kit (TaKaRa), according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2020Quote: ... 0.4 μL of 25 mM Dntp (Advantage UltraPure dNTP Combination Kit) (TaKaRa), 4.0 μL of 5× SSIV Buffer (Thermo Fisher Scientific) ...
-
bioRxiv - Molecular Biology 2020Quote: ... qRT-qPCR was performed with a SYBR PrimeScript RT-qPCR Kit (Takara) for 40 cycles at 95°C for 5 s and 60°C for 30 s on a Light Cycler 480 Real-Time PCR System (Roche ...
-
bioRxiv - Cell Biology 2022Quote: ... Viruses were titered using the Lenti-X p24 rapid titer kit (Takara). SH-SY5Y were transduced in 96-well plates at multiplicity of infection (MOI ...
-
bioRxiv - Developmental Biology 2022Quote: ... cDNA was generated with a PrimeScript RT Kit (Takara, Otsu, Shiga, Japan). Q-PCR was conducted to detect RNA amounts using FastStart Universal SYBR Green Master (ROX ...
-
bioRxiv - Immunology 2022Quote: ... Supernatants were purified using Capturem™ His-Tagged Purification kit (Takara Bio), then dialyzed by PBS buffer overnight ...
-
bioRxiv - Immunology 2021Quote: ... LDH release was quantified using an LDH Cytotoxicity Detection Kit (Takara BioProduct) according to the manufacturer’s instructions and normalized to mock-infected cells.
-
bioRxiv - Genomics 2020Quote: ... and RNA-seq libraries generated using the SMARTer cDNA synthesis kit (Takara), according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... Quantitative PCR was carried out using SYBR Green Q-PCR kit (Takara).
-
bioRxiv - Molecular Biology 2021Quote: ... HEK293T cells were transfected using the CalPhos mammalian transfection kit (TaKaRa Clontech) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2019Quote: ... All PCR products were inserted using the In-Fusion cloning kit (Clontech) into the pBMDEL which had been linearized with BfuAI ...
-
bioRxiv - Molecular Biology 2019Quote: ... cDNA was synthesized using PrimeScript RT reagent Kit with gDNA Eraser (TAKARA). PCR reactions were prepared using FastStart SYBR Green Master (Roche Applied Science) ...
-
bioRxiv - Synthetic Biology 2019Quote: ... All cloning procedures were performed using the in-fusion cloning kit (Clontech).
-
bioRxiv - Genomics 2019Quote: ... Reverse transcription was performed with a PrimeScript RT-PCR Kit (TaKaRa, Japan). Quantitative real-time PCR (qRT-PCR ...
-
bioRxiv - Developmental Biology 2019Quote: ... The RNA was reverse-transcribed with PrimeScript™ RT reagent Kit (Takara) and PCR analyzed with primers chd-RT-F and chd-RT-R (Table 1) ...
-
bioRxiv - Developmental Biology 2019Quote: ... the cDNA was amplified with the Advantage 2 PCR Kit (Clontech Takara) containing buffer ...
-
bioRxiv - Developmental Biology 2019Quote: ... the cDNA was amplified with the Advantage 2 PCR Kit (Clontech Takara) containing buffer ...
-
bioRxiv - Neuroscience 2020Quote: ... were generated using the In-Fusion® HD cloning kit (Takara Bio) according to manufacturer’s instructions or were purchased (Addgene) ...
-
bioRxiv - Microbiology 2021Quote: ... reverse transcription was performed with the PrimeScript RT reagent kit (RR037A, TaKaRa).
-
bioRxiv - Genomics 2020Quote: ... total RNA was reverse-transcribed with the PrimeScript One Step Kit (Takara) using gene-specific primers for GFP (CAAACTCATCAATGTATCTTATCATG ...
-
bioRxiv - Genomics 2020Quote: ... and reverse transcribed using PrimeScriptⅡ 1st strand cDNA Synthesis Kit (TaKaRa, Japan). The sequence of the LFY gene was amplified by PCR in 50-µL reaction mixture by using TaKaRa Ex Taq Hot Start Version (TaKaRa Bio ...
-
bioRxiv - Neuroscience 2020Quote: ... RNAseq library was prepared by DNA SMART ChIP Seq Kit (TAKARA #101617). RNA Sequencing was performed on Illumina NextSeq 500 desktop Next Generation Sequencing (NGS ...
-
bioRxiv - Developmental Biology 2021Quote: ... and amplified sequences were inserted using InFusion (InFusion HD Cloning kit, Clontech). Plasmid constructs were injected into one-cell zygotes and integrated into the genome via Ac-mediated recombination ...
-
bioRxiv - Neuroscience 2020Quote: ... The transgene plasmid was generated using the InFusion HD Kit (Clontech, 638910) and the NucleoBond Xtra Midi EF Kit (Macherey-Nagel ...
-
bioRxiv - Neuroscience 2021Quote: ... cDNA sequencing libraries were prepared using a SmartSeq HT kit (Takara Bio) and Illumina Nextera XT kit (Illumina Inc.) ...
-
bioRxiv - Cancer Biology 2020Quote: ... using the Nextera Primer P5 (ICELL8® 3’ DE Kit, Takara Bio), Nextera XT DNA Library Preparation Kit (Illumina ...
-
bioRxiv - Cell Biology 2021Quote: ... and inserted into the pFastBac vector using In-Fusion kit (TaKaRa # 638910). Inserts encoding wild-type or mutant Myo1e fragments (motor domain + IQ motif ...
-
bioRxiv - Genomics 2021Quote: ... by calcium phosphate transfection with CalPhos™ Mammalian Transfection Kit (Takara, 631312) following the manufacturer’s protocol into HEK293T cells ...
-
bioRxiv - Physiology 2021Quote: ... The PrimeScript RT reagent kit (Takara Bio, Otsu, Japan; cat. no. RR037A) was used to reverse transcribe total RNA (2 μg ...
-
bioRxiv - Bioengineering 2021Quote: ... Libraries were prepared using the Clontech SMARTer Stranded Total RNAseq Kit (Clontech), precleaned ...
-
bioRxiv - Genetics 2021Quote: ... AD-MSCs and iPSCs by using the Genomic DNA Extraction Kit (TaKaRa). PCR was performed by using Q5 High-Fidelity DNA Polymerase (New England Biolabs ...
-
bioRxiv - Plant Biology 2021Quote: ... and cDNA was synthesized with the PrimeScript TMRT Master Mix kit (TaKaRa). qRT□PCR reactions were performed in triplicate using Mastercycler ep realplex (Eppendorf ...
-
bioRxiv - Plant Biology 2020Quote: ... and the resulting fragments were ligated using a DNA Ligation kit (Takara). The cDNAs of NPH3SA and NPH3SE within the pENTR vectors were transferred to both pH35GS and pH35YG binary vectors (Yamaguchi et al. ...
-
bioRxiv - Genomics 2019Quote: ... cDNA was synthesized by using SMARTer PCR cDNA Synthesis Kit (Clontech, CA) according to the IsoSeq protocol (Pacific Biosciences ...
-
bioRxiv - Plant Biology 2020Quote: ... cDNA was synthesized using Primescript II 1st Strand cDNA Synthesis Kit (Takara) according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... Reverse transcriptase was performed using the PrimeScript™ RT-PCR Kit (Takara). mRNA relative levels of SIGLEC1 were measured by two-step quantitative RT-PCR and normalized to GAPDH mRNA expression using the DDCt method ...
-
bioRxiv - Microbiology 2019Quote: ... RNAseq libraries were prepared with the SMARTer Stranded RNA-seq kit (TaKaRa) using 25ng of RNA input and 12 cycles for library amplification ...
-
bioRxiv - Molecular Biology 2021Quote: Total RNA was isolated following the protocol by the Trizol kit (TAKARA). SYBR Green (Roche ...