Labshake search
Citations for Takara Bio :
1301 - 1349 of 1349 citations for 6 Bromo 2 methylthiazolo 5 4 b pyrazine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2022Quote: ... PCR assays were performed in final volumes of 25 μl containing 12.5 μl of 2 × PCR Taq Mastermix (MgCl, dNTP, Taq enzyme) (Takara Bio Inc., Japan); 0.5μl of each primer (10 mmol/L) ...
-
bioRxiv - Molecular Biology 2022Quote: ... and amplified by PCR using a forward primer containing a T7 promoter sequence (Supplemental Table 10) with the Advantage HF 2 kit (Takara Bio 639124) and the following cycling conditions ...
-
bioRxiv - Plant Biology 2023Quote: ... genomic sequences at the length of 700∼2 000 bp were amplified from genomic DNAs with PrimeStar Max DNA polymerase (Takara, cat. R045A). The resulting fragments were cloned into vector backbones derived from pPY22 (mNeonGreen-Hygromycin B ...
-
bioRxiv - Cell Biology 2024Quote: ... A volume of 2 µl of cDNA was used as template for qPCR using SYBR Premix Ex Taq (Takara, Shiga, Japan, #RR420A). qPCR reactions were performed using an ABI 7500 system (Applied Biosystems ...
-
bioRxiv - Microbiology 2023Quote: ... The N-terminal 3xFLAG-tagged ORF67.5 expression plasmid was constructed using the insert extracted from a previously constructed N-terminal 2×S-tagged ORF67.5 expression plasmid digested with EcoRI and SalI (Takara Bio, Shiga, Japan) (32) ...
-
bioRxiv - Microbiology 2023Quote: ... nine DNA fragments encoding the partial genome of SARS-CoV-2 (hCoV-19/Japan/TY-WK-521/2020) were amplified by PCR using PrimeSTAR GXL DNA polymerase (Takara, Cat# R050A). A linker fragment encoding the hepatitis delta virus ribozyme ...
-
bioRxiv - Cell Biology 2023Quote: ... A total of 1-2 μg RNA was reverse transcribed with random hexamers using PrimeScript 1st strand cDNA synthesis kit (Takara Bio, Japan) per the manufacturer’s protocol on Verti 96 well thermocycler (Thermo Scientific ...
-
bioRxiv - Microbiology 2023Quote: ... The amplicons were analyzed using 2% agarose gel electrophoresis with ethidium bromide staining and using a 2000-bp DNA ladder marker (Takara, Tokyo, Japan).
-
bioRxiv - Genomics 2023Quote: ... the human mtDNA control region (m.1-573 and m.16024-16569) was enriched using four overlapping PCR amplicons using high fidelity TaKaRa PrimeSTAR GXL DNA polymerase (TaKaRa; Table 2). PCR products were visually inspected by agarose gel ...
-
bioRxiv - Biophysics 2023Quote: ... Cell debris was pelleted down and the supernatant was run on a 2 mL column volume (CV) TALON cobalt affinity resin (Takara Bio #635504) equilibrated in CoWB/TCEP (100 mM NaCl (Sigma-Aldrich 746398) ...
-
bioRxiv - Cell Biology 2023Quote: ... A total of 2 μL of cDNA product was used for subsequent RT–qPCR analysis using SYBR1 Premix Ex Taq (Takara, Dalian, Japan). All primers used in this study are shown in Table S1.
-
bioRxiv - Microbiology 2023Quote: ... of the resulting fragments were subjected to a CPER reaction in a 50 μl volume using 2 μl of PrimeStar GXL DNA polymerase (Takara Bio; #R050A). The following cycling conditions were used for CPER ...
-
bioRxiv - Genetics 2023Quote: ... RNA from 2 retinae of a mouse was extracted using the NucleoSpin® RNA kits (Takara Bio USA, Inc., San Jose, CA). RNA sample concentration and quality was determined with NanoDrop Oneᶜ Microvolume UV-Vis Spectrophotometers (ThermoFisher Scientific ...
-
bioRxiv - Immunology 2023Quote: ... cDNA library was generated from 2 nanograms of total RNA using Smart-Seq V4 Ultra Low Input RNA Kit (Takara catalog#: 634894). 150 picograms of cDNA was used to make sequencing libraries by Nextera XT DNA Sample Preparation Kit (Illumina catalog# ...
-
bioRxiv - Plant Biology 2024Quote: ... A volume of 2 µg of total RNA was reverse transcribed into single-stranded cDNA using AMV reverse transcriptase (TaKaRa, Dalian, China). The primer sequences used for qRT-PCR are listed in Supplementary file 1b ...
-
bioRxiv - Genetics 2024Quote: ... The reaction was performed in a 20 µl reaction mixtures comprising 10 µl of 2×TB Green® Premix Ex Taq™ (Tli RNaseH Plus) (Cat. no. RR420A, TaKaRa), 1 µl of cDNA ...
-
bioRxiv - Genetics 2024Quote: ... The reaction was performed in a 20 µl reaction mixtures comprising 10 µl of 2×TB Green® Premix Ex Taq™ (Tli RNaseH Plus) (Cat#RR420A, TaKaRa), 1 µl of cDNA ...
-
bioRxiv - Microbiology 2021Quote: Antibody sequencing was performed as previously described (Simonich et al., 2019; Vigdorovich et al., 2016) using the SMARTer RACE 5’/3’ Kit (Takara Bio USA Inc., Mountainview, CA). Briefly ...
-
bioRxiv - Genomics 2019Quote: ... the beads were washed twice with 50 μl 80% freshly-prepared EtOH on the magnetic stand and the dried beads pellets were resuspended in 4 μL elution buffer (RNAse inhibitor 1/200 Takara, CDS primer 0.5 μL in RNAse free water) immediately followed by an incubation at 72°C for 3 min ...
-
bioRxiv - Cell Biology 2020Quote: ... and Evl (isoform 2) were amplified by PCR from a NIH 3T3 cDNA library and ligated into suitable sites of pEGFP-C1 (Clontech, Palo Alto, CA). VASP cDNA was additionally inserted into the BglII and SalI sites of pmCherry (Addgene ID ...
-
bioRxiv - Plant Biology 2020Quote: ... About 2 μg of the isolated RNA was used to synthesize the first-strand cDNA using reverse transcriptase enzyme (Takara Bio, Clontech, USA). The cDNA was diluted seven times with sterile Milli-Q water (1:7 ratio) ...
-
bioRxiv - Cell Biology 2022Quote: ... Transformants were selected on synthetic media containing yeast nitrogen base (YNB, Difco) supplemented with 2 % glucose and DropOut supplements lacking uracil (Clontech, Mountain View, CA). Single colonies were used to inoculate 5 mL liquid YNB media supplemented with 2 % glucose and DropOut supplements lacking uracil ...
-
bioRxiv - Molecular Biology 2019Quote: ... Klotho genotypes were determined by semi-quantitative PCR using LA-Tag DNA polymerase and TaKaRa buffer with Mg+2 (TaKaRa Shuzo, Tokyo, Japan) as follows ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... The SARS-CoV-2 viral load was quantified in culture supernatant using RT-QPCR with primer probes targeting E gene of SARS-CoV-2 using PrimeDirect Probe RT-qPCR Mix (TaKaRa Bio USA, Inc) and Applied Biosystems QuantStudio3 real-time PCR system (Applied Biosystems ...
-
bioRxiv - Plant Biology 2021Quote: ... Reverse transcription was then carried out using total RNA and oligo-dT primers to synthesize the first strand cDNA using the PrimeScript One-Step RT-PCR Kit (Ver.2, Takara Biotechnology, Dalian, China) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... containing a Kozak sequence added right before the ATG (RefSeq NC_045512.2) were synthesized by Eurofins (Ebersberg, EU) and subcloned into the pIRES2 vector with eGFP in the second cassette (Takara Bio Europe, EU). Truncated Δ4 and Δ8 E proteins ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... adhaerens yeast 2-hybrid cDNA library was constructed using the Make Your Own “Mate & PlateTM” Library System (Takara Bio USA, Mountain View, CA), using whole animal total RNA extracted from approximately 30 animals using a Nucleospin RNA Plus Mini Kit (Macherey-Nagel ...
-
bioRxiv - Genetics 2024Quote: ... PCR was conducted as described earlier (section: RNAi-mediated knockdown of Pmtra-2) but using the proofreading PrimeSTAR HS DNA Polymerase (Takara Bio, Shiga, Japan) and Ex Taq DNA Polymerase (Takara Bio ...
-
bioRxiv - Biochemistry 2024Quote: ... Sub-library specific primers were then used to amplify 1 ul of cDNA template for 24 cycles using Advantage 2 PCR Mix (Takara Bio, Cat. 639206). Finally ...
-
bioRxiv - Neuroscience 2023Quote: ... were transiently cotransfected with a 2:1 mixture of Nav1.7-expressing plasmid8 and a pIRES2-ZsGreen bicistronic plasmid (Takara Bio, San Jose, CA) expressing ZsGreen and mouse FHF2B proteins.10 The same pIRES2-ZsGreen plasmid without FHF2 coding sequence served as the control ...
-
bioRxiv - Molecular Biology 2023Quote: ... was performed by quantitative real-time polymerase chain reaction (PCR) using the AAVpro™ Titration Kit (for Real Time PCR) Ver.2 (Takara Bio Inc), according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2023Quote: ... which was measured using a real-time PCR assay with a SARS-CoV-2 direct detection RT‒qPCR kit (Takara Bio, Siga, Japan). The IC50 was calculated by IC50 Calculator (https://www.aatbio.com/tools/ic50-calculator ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... we performed Rapid-Amplification-of-cDNA-Ends (RACE) PCR using transcript-specific primers and the SMARTer RACE 5’/3’ Kit (Takara Bio USA, Inc., Mountain View, CA) according to the manufacturer’s instructions.
-
bioRxiv - Cell Biology 2020Quote: The mitochondrial targeting sequence fused with the 5’-end of DsRed2 (MTS-DsRed2) was digested from the pDsRed2-Mito vector (Clontech Laboratories, Inc., Palo Alto, CA, USA) with restriction enzymes and inserted into the pMXs-puro retroviral vector (Cell Biolabs ...
-
bioRxiv - Biochemistry 2019Quote: ... cochleariae fat body for 3’ rapid amplification of cDNA ends (3’ RACE) was synthesized according to the manual from SMARTer RACE 5’/3’ Kit (Takara Bio, Inc. Mountain View, CA, USA). All cDNA templates were stored at −20 °C after synthesis.
-
bioRxiv - Molecular Biology 2019Quote: ... This region was PCR amplified with DinoSL and KbrSRP-U6R1 primer set (sequences and Tm in Table 2) using the high fidelity PrimeSTAR HS DNA Polymerase (Takara, Kusatsu, Shiga Prefecture, Japan) at 94°C for 1 min ...
-
bioRxiv - Cell Biology 2021Quote: ... fragments #1 and #2 were inserted into the PB-EF1-MCS-IRES-Neo vector using the In-Fusion HD Cloning Kit (639648; Takara Bio Inc. Kusatsu, Japan). This resulted in the PB-EF1-MCS-IRES-Zeo vector ...
-
bioRxiv - Microbiology 2021Quote: ... The knockout construct was developed through In-Fusion using the purified amplicons based on the manufacturer’s instructions with the insert to vector ratio of 2:1 (Takara Bio, Mountain View, CA, USA) and transformed into E ...
-
bioRxiv - Bioengineering 2019Quote: KOD-Plus-Ver.2 DNA polymerase (Toyobo, Osaka, Japan) was used to amplify ldsDNAs (PCR amplicons) using the pEGFP-C1 (Clontech, Mountain View, CA, USA) plasmid as the template ...
-
bioRxiv - Cancer Biology 2022Quote: Tgfb-Induced-Enhancer:Beta-globin-minimal-promoter-EGFP:pA pDestTol2pA2 was cloned by PCR amplifying the enhancer (chr1:22747452-22747734) in Figure 1A using A375 human melanoma gDNA (Forward primer: TTCTTTGTCATCCTGGTAGAGCAAATCGAG, Reverse primer: GACAGGTCGCACCTGAGTCC)(Advantage® 2 PCR Kit, Clontech #639207, Kyoto, Japan). PCR product was gel purified (Qiagen #28604 ...
-
bioRxiv - Cell Biology 2022Quote: ... while pGADT7-CmVPS41s and pGADT7-T control prey plasmids were transformed into yeast strain Y187 following the Yeastmaker Yeast Transformation System 2 instructions (Clontech by Takara Bio, Mountain View, USA). The transformed cells were grown either in SD-Trp agar plates for Y2HGold or in SD-Leu agar plates for Y187 at 30 ºC for 3-5 days ...
-
bioRxiv - Bioengineering 2024Quote: ... To synthesize cDNA, total RNA (8 µL, ca. 500 ng) was mixed with 2 µL of PrimeScript™ RT Master Mix (Takara Bio, Kusatsu, Japan) and incubated at 37°C for 15 min ...
-
bioRxiv - Immunology 2023Quote: ... Human lung fibroblast MRC-5 cells were obtained from ATCC® (CCL-171™) and Lenti-X™ 293T cells were obtained from TakaRa (Mountain View CA, USA). All were propagated in complete DMEM (Sigma-Aldrich ...
-
bioRxiv - Microbiology 2024Quote: ... encoding region at the 3’ terminus of a putative linearized ambi-like virus was done following the protocol of the SMARTer® RACE 5’/3’ Kit (Takara Bio USA, Mountain View, CA, USA), employing a specific primer designed by Primer3-2.3.7 under Geneious (Supplemental Table S2) ...
-
bioRxiv - Neuroscience 2024Quote: ... The PCR-amplified promoter fragments were inserted into the XhoI-AgeI site of the pAAV using Ligation high Ver.2 (LGK-201; Toyobo: hGFAP(ABC1D) or In-Fusion HD Cloning Kit (Takara Bio, Shiga, Japan: mMBP promoter).
-
bioRxiv - Cancer Biology 2021Quote: ... at a molar ratio of 2:1:1 and transfected into the Lenti-X™ 293T packaging cell line (632180, TaKaRa Bio Inc., Kusatsu, Shiga, Japan) using Xfect™ Transfection Reagent (631317 ...
-
bioRxiv - Biochemistry 2021Quote: DNA encoding the PX domain from the Qc SNARE Vam7 (Amino acyl residues 2-123) was amplified by PCR with CloneAMP HiFi PCR premix (Takara Bio USA, Mountain View, CA, USA). The amplified DNA fragment was cloned into BamHI and SalI digested pGST parallel1 vector (Sheffield et al.,1999 ...
-
bioRxiv - Cell Biology 2022Quote: ... while pGADT7-CmVPS41s and pGADT7-T control prey plasmids were transformed into yeast strain Y187 following the Yeastmaker Yeast Transformation System 2 instructions (Clontech by Takara Bio, Mountain View, USA). The transformed cells were grown either in SD-Trp agar plates for Y2HGold or in SD-Leu agar plates for Y187 at 30 ºC for 3-5 days ...
-
bioRxiv - Cancer Biology 2023Quote: ... in a molar ratio of 2:1:1 and transfected into the Lenti-X™ 293T packaging cell line (632180, TaKaRa Bio Inc., Kusatsu, Shiga, Japan) using Xfect™ Transfection Reagent (631317 ...