Labshake search
Citations for Takara Bio :
1251 - 1280 of 1280 citations for 6 Bromo 2 methylthiazolo 5 4 b pyrazine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: Antibody sequencing was performed as previously described (Simonich et al., 2019; Vigdorovich et al., 2016) using the SMARTer RACE 5’/3’ Kit (Takara Bio USA Inc., Mountainview, CA). Briefly ...
-
bioRxiv - Genomics 2019Quote: ... the beads were washed twice with 50 μl 80% freshly-prepared EtOH on the magnetic stand and the dried beads pellets were resuspended in 4 μL elution buffer (RNAse inhibitor 1/200 Takara, CDS primer 0.5 μL in RNAse free water) immediately followed by an incubation at 72°C for 3 min ...
-
bioRxiv - Cell Biology 2020Quote: ... and Evl (isoform 2) were amplified by PCR from a NIH 3T3 cDNA library and ligated into suitable sites of pEGFP-C1 (Clontech, Palo Alto, CA). VASP cDNA was additionally inserted into the BglII and SalI sites of pmCherry (Addgene ID ...
-
bioRxiv - Plant Biology 2020Quote: ... About 2 μg of the isolated RNA was used to synthesize the first-strand cDNA using reverse transcriptase enzyme (Takara Bio, Clontech, USA). The cDNA was diluted seven times with sterile Milli-Q water (1:7 ratio) ...
-
bioRxiv - Cell Biology 2022Quote: ... Transformants were selected on synthetic media containing yeast nitrogen base (YNB, Difco) supplemented with 2 % glucose and DropOut supplements lacking uracil (Clontech, Mountain View, CA). Single colonies were used to inoculate 5 mL liquid YNB media supplemented with 2 % glucose and DropOut supplements lacking uracil ...
-
bioRxiv - Molecular Biology 2019Quote: ... Klotho genotypes were determined by semi-quantitative PCR using LA-Tag DNA polymerase and TaKaRa buffer with Mg+2 (TaKaRa Shuzo, Tokyo, Japan) as follows ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... The SARS-CoV-2 viral load was quantified in culture supernatant using RT-QPCR with primer probes targeting E gene of SARS-CoV-2 using PrimeDirect Probe RT-qPCR Mix (TaKaRa Bio USA, Inc) and Applied Biosystems QuantStudio3 real-time PCR system (Applied Biosystems ...
-
bioRxiv - Plant Biology 2021Quote: ... Reverse transcription was then carried out using total RNA and oligo-dT primers to synthesize the first strand cDNA using the PrimeScript One-Step RT-PCR Kit (Ver.2, Takara Biotechnology, Dalian, China) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... containing a Kozak sequence added right before the ATG (RefSeq NC_045512.2) were synthesized by Eurofins (Ebersberg, EU) and subcloned into the pIRES2 vector with eGFP in the second cassette (Takara Bio Europe, EU). Truncated Δ4 and Δ8 E proteins ...
-
bioRxiv - Neuroscience 2023Quote: ... were transiently cotransfected with a 2:1 mixture of Nav1.7-expressing plasmid8 and a pIRES2-ZsGreen bicistronic plasmid (Takara Bio, San Jose, CA) expressing ZsGreen and mouse FHF2B proteins.10 The same pIRES2-ZsGreen plasmid without FHF2 coding sequence served as the control ...
-
bioRxiv - Molecular Biology 2023Quote: ... was performed by quantitative real-time polymerase chain reaction (PCR) using the AAVpro™ Titration Kit (for Real Time PCR) Ver.2 (Takara Bio Inc), according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2023Quote: ... which was measured using a real-time PCR assay with a SARS-CoV-2 direct detection RT‒qPCR kit (Takara Bio, Siga, Japan). The IC50 was calculated by IC50 Calculator (https://www.aatbio.com/tools/ic50-calculator ...
-
bioRxiv - Genetics 2024Quote: ... PCR was conducted as described earlier (section: RNAi-mediated knockdown of Pmtra-2) but using the proofreading PrimeSTAR HS DNA Polymerase (Takara Bio, Shiga, Japan) and Ex Taq DNA Polymerase (Takara Bio ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... adhaerens yeast 2-hybrid cDNA library was constructed using the Make Your Own “Mate & PlateTM” Library System (Takara Bio USA, Mountain View, CA), using whole animal total RNA extracted from approximately 30 animals using a Nucleospin RNA Plus Mini Kit (Macherey-Nagel ...
-
bioRxiv - Biochemistry 2024Quote: ... Sub-library specific primers were then used to amplify 1 ul of cDNA template for 24 cycles using Advantage 2 PCR Mix (Takara Bio, Cat. 639206). Finally ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... we performed Rapid-Amplification-of-cDNA-Ends (RACE) PCR using transcript-specific primers and the SMARTer RACE 5’/3’ Kit (Takara Bio USA, Inc., Mountain View, CA) according to the manufacturer’s instructions.
-
bioRxiv - Cell Biology 2020Quote: The mitochondrial targeting sequence fused with the 5’-end of DsRed2 (MTS-DsRed2) was digested from the pDsRed2-Mito vector (Clontech Laboratories, Inc., Palo Alto, CA, USA) with restriction enzymes and inserted into the pMXs-puro retroviral vector (Cell Biolabs ...
-
bioRxiv - Biochemistry 2019Quote: ... cochleariae fat body for 3’ rapid amplification of cDNA ends (3’ RACE) was synthesized according to the manual from SMARTer RACE 5’/3’ Kit (Takara Bio, Inc. Mountain View, CA, USA). All cDNA templates were stored at −20 °C after synthesis.
-
bioRxiv - Molecular Biology 2019Quote: ... This region was PCR amplified with DinoSL and KbrSRP-U6R1 primer set (sequences and Tm in Table 2) using the high fidelity PrimeSTAR HS DNA Polymerase (Takara, Kusatsu, Shiga Prefecture, Japan) at 94°C for 1 min ...
-
bioRxiv - Cell Biology 2021Quote: ... fragments #1 and #2 were inserted into the PB-EF1-MCS-IRES-Neo vector using the In-Fusion HD Cloning Kit (639648; Takara Bio Inc. Kusatsu, Japan). This resulted in the PB-EF1-MCS-IRES-Zeo vector ...
-
bioRxiv - Microbiology 2021Quote: ... The knockout construct was developed through In-Fusion using the purified amplicons based on the manufacturer’s instructions with the insert to vector ratio of 2:1 (Takara Bio, Mountain View, CA, USA) and transformed into E ...
-
bioRxiv - Bioengineering 2019Quote: KOD-Plus-Ver.2 DNA polymerase (Toyobo, Osaka, Japan) was used to amplify ldsDNAs (PCR amplicons) using the pEGFP-C1 (Clontech, Mountain View, CA, USA) plasmid as the template ...
-
bioRxiv - Cancer Biology 2022Quote: Tgfb-Induced-Enhancer:Beta-globin-minimal-promoter-EGFP:pA pDestTol2pA2 was cloned by PCR amplifying the enhancer (chr1:22747452-22747734) in Figure 1A using A375 human melanoma gDNA (Forward primer: TTCTTTGTCATCCTGGTAGAGCAAATCGAG, Reverse primer: GACAGGTCGCACCTGAGTCC)(Advantage® 2 PCR Kit, Clontech #639207, Kyoto, Japan). PCR product was gel purified (Qiagen #28604 ...
-
bioRxiv - Cell Biology 2022Quote: ... while pGADT7-CmVPS41s and pGADT7-T control prey plasmids were transformed into yeast strain Y187 following the Yeastmaker Yeast Transformation System 2 instructions (Clontech by Takara Bio, Mountain View, USA). The transformed cells were grown either in SD-Trp agar plates for Y2HGold or in SD-Leu agar plates for Y187 at 30 ºC for 3-5 days ...
-
bioRxiv - Bioengineering 2024Quote: ... To synthesize cDNA, total RNA (8 µL, ca. 500 ng) was mixed with 2 µL of PrimeScript™ RT Master Mix (Takara Bio, Kusatsu, Japan) and incubated at 37°C for 15 min ...
-
bioRxiv - Immunology 2023Quote: ... Human lung fibroblast MRC-5 cells were obtained from ATCC® (CCL-171™) and Lenti-X™ 293T cells were obtained from TakaRa (Mountain View CA, USA). All were propagated in complete DMEM (Sigma-Aldrich ...
-
bioRxiv - Cancer Biology 2021Quote: ... at a molar ratio of 2:1:1 and transfected into the Lenti-X™ 293T packaging cell line (632180, TaKaRa Bio Inc., Kusatsu, Shiga, Japan) using Xfect™ Transfection Reagent (631317 ...
-
bioRxiv - Biochemistry 2021Quote: DNA encoding the PX domain from the Qc SNARE Vam7 (Amino acyl residues 2-123) was amplified by PCR with CloneAMP HiFi PCR premix (Takara Bio USA, Mountain View, CA, USA). The amplified DNA fragment was cloned into BamHI and SalI digested pGST parallel1 vector (Sheffield et al.,1999 ...
-
bioRxiv - Cell Biology 2022Quote: ... while pGADT7-CmVPS41s and pGADT7-T control prey plasmids were transformed into yeast strain Y187 following the Yeastmaker Yeast Transformation System 2 instructions (Clontech by Takara Bio, Mountain View, USA). The transformed cells were grown either in SD-Trp agar plates for Y2HGold or in SD-Leu agar plates for Y187 at 30 ºC for 3-5 days ...
-
bioRxiv - Cancer Biology 2023Quote: ... in a molar ratio of 2:1:1 and transfected into the Lenti-X™ 293T packaging cell line (632180, TaKaRa Bio Inc., Kusatsu, Shiga, Japan) using Xfect™ Transfection Reagent (631317 ...