Labshake search
Citations for Takara Bio :
1251 - 1300 of 5521 citations for Urea Nitrogen BUN Detection Kit 10 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2023Quote: ... paired-ended libraries were constructed using SMART ChIPseq kit (TAKARA) and sequenced using HiseqX ...
-
bioRxiv - Plant Biology 2023Quote: ... and standard PCR was performed using ExTaq HS kit (TaKaRa). Control reactions were run using wild-type DNA as a template.
-
bioRxiv - Plant Biology 2024Quote: ... or the SMART-Seq mRNA LP Kit (Takara Bio USA) (for pre-parasitic J2 library generation) ...
-
bioRxiv - Microbiology 2023Quote: ... using an In-Fusion HD Cloning Kit (TaKaRa, Cat# Z9633N). Plasmids were amplified using NEB 5-alpha F′ Iq competent Escherichia coli (NEB ...
-
bioRxiv - Neuroscience 2023Quote: ... cDNAs were prepared with SmarSeq Ultra Low input kit (Takara).
-
bioRxiv - Cell Biology 2023Quote: ... by PCR using a PrimeSTAR Mutagenesis Basal Kit (Takara, R046A) and the following primers ...
-
bioRxiv - Microbiology 2024Quote: ... Conventional PCR was performed with TaKaRa EX Taq kit (TaKaRa) and included 5 µL 10X PCR Buffer (Mg2+ plus) ...
-
bioRxiv - Developmental Biology 2024Quote: ... The SMART-seq mRNA kit (Takara, San Jose, California, USA) was used to construct cDNA ...
-
bioRxiv - Neuroscience 2024Quote: ... Infusion cloning (Takara-Bio In-Fusion HD cloning Kit; 639650) was used to clone in EF1-alpha promoter generating a pAAV.U6.shRLuc.EF1-α.ZsGreen.SV40 plasmid and express ZsGreen under EF1-α promoter (Table 2) ...
-
GIBBERELLIN SIGNALING THROUGH RGA SUPPRESSES GCN5 EFFECT ON STAMEN ELONGATION OF ARABIDOPSIS FLOWERSbioRxiv - Plant Biology 2024Quote: ... The PrimeScriptTM 1st strand cDNA synthesis kit (Takara, Shiga, Japan) was used for reverse transcription ...
-
bioRxiv - Cell Biology 2024Quote: ... and reverse-transcribed using the cDNA Synthesis kit (Takara, Japan). The RNA quantity and density were verified by a spectrophotometer ...
-
bioRxiv - Neuroscience 2024Quote: ... using SMARTer Ultra Low Input kit (634940, Takara Bio/Clontech). All samples were sequenced in parallel at two different time points using Illumina NovaSeq 6000 flow cell and fastq files have been deposited on the Gene Expression Omnibus (GEO ...
-
bioRxiv - Genetics 2024Quote: ... and indexing primers (DNA HT Dual Index kit, Takara Bio) with all procedures performed as per the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2024Quote: ... cDNA was synthesized using the PrimeScript RT-PCR kit (Takara), according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2024Quote: ... using SMARTer Ultra Low Input kit (634940, Takara Bio/Clontech). All samples were sequenced in parallel at two different time points using Illumina NovaSeq 6000 flow cell and fastq files have been deposited on the Gene Expression Omnibus (GEO ...
-
bioRxiv - Immunology 2024Quote: ... and spleen tissues using an RNAiso Plus kit (Takara Bio), and subsequently reverse transcribed into cDNAs ...
-
bioRxiv - Biophysics 2024Quote: ... were generated using In-Fusion HD Cloning kit (Clontech (TaKaRA)) following the supplier’s instructions ...
-
bioRxiv - Biophysics 2024Quote: ... were generated using In-Fusion HD Cloning kit (Clontech (TaKaRA)) following the supplier’s instructions ...
-
bioRxiv - Molecular Biology 2024Quote: ... restriction sites by In-Fusion® HD Cloning Kit (Takara) following the user guide instructions ...
-
bioRxiv - Neuroscience 2024Quote: ... and the Advantage 2 PCR kit (Takara/Clontech Cat # 639207). Libraries were checked for quality and approximate concentration on a 1% agarose gel.
-
bioRxiv - Neuroscience 2024Quote: ... and the Advantage 2 PCR kit (Takara/Clontech Cat # 639207). Libraries were checked for quality and approximate concentration on a 1% agarose gel.
-
bioRxiv - Developmental Biology 2024Quote: ... SMART-Seq v4 Ultra low input RNA Kit (Takara, #634889) was used for first-strand and second-strand cDNA synthesis and double-stranded cDNA end repair ...
-
bioRxiv - Microbiology 2024Quote: ... Cloning was performed with In-Fusion HD cloning kit (Takara) for each candidate into pGADT7 and pGBKT7 vectors (Clontech ...
-
bioRxiv - Genomics 2020Quote: ... 20 ng of sheared DNA was used for the library construction with ThruPLEX DNA Seq Kit and DNA HT Dual Index Kit (Takara Bio USA, Mountain View, CA). Plasma and tumor DNA libraries were sequenced using paired-end 50 bp reads generated on the NovaSeq 6000 Sequencing System (Illumina ...
-
bioRxiv - Genomics 2020Quote: The cfDNA library construction was performed with the SMARTer ThruPLEX Plasma-Seq Kit and DNA HT Dual Index Kit (Takara Bio USA, Mountain View, CA), as per manufacturer’s instructions ...
-
bioRxiv - Systems Biology 2021Quote: ... We prepared ligation-free ribosome profiling and total RNA-seq libraries from the clarified polysome lysates treated for 6 hours following the instructions provided with their respective kits (smarter-seq smRNA-seq kit, Takara-Clontech; NEBnext Ultra-Directional II) augmented with our previously-published ligation-free ribosome profiling protocol42 ...
-
bioRxiv - Biochemistry 2022Quote: ... Total RNA was isolated using RNAqueous isolation kit (Thermo-Fisher, Waltham MA) and mRNA reverse transcribed using PrimeScript RT Reagent Kit (Takara Bio USA, Mountain View CA). Quantitative PCR reactions were carried out using PowerUp SYBR-Green master mix using StepOne Real-Time PCR systems (Applied Biosystems) ...
-
bioRxiv - Plant Biology 2020Quote: ... 10 AtCBLs prey vectors were co-transformed into the yeast strain AH109 following manufacturer’s instructions (Clontech, CA, USA). The empty vectors pTOOL27 and pTOOL28 were also co-transformed into yeast with each prey or bait plasmid respectively to confirm that bait does not autonomously activate the reporter genes in the absence of the prey protein.
-
bioRxiv - Genetics 2021Quote: ... followed by a final extension at 72 °C for 10 min by using Takara Taq polymerase (Clontech, #TAKR001). To remove the DsRed cassette ...
-
bioRxiv - Microbiology 2021Quote: ... and 10 ng of Renilla luciferase (pTK r.luc) by using 4 µl of TransIT 293 (Takara, Shiga, Japan) and 100 µl of OPTI- MEM (Thermo Fisher Scientific ...
-
bioRxiv - Biophysics 2021Quote: ... and sgRNA were cultured at 37°C and 5% CO2 in high-glucose Dulbecco’s modified Eagle’s medium (DMEM, HyClone) supplemented with 10% (v/v) FBS (ClonTech), 250 µg/ml hygromycin ...
-
bioRxiv - Microbiology 2021Quote: ... 10 μg of Spike expressor and 2 μg of a green fluorescent protein (GFP) expressor (pIRES2-eGFP; Clontech) was transfected into 2 × 106 293T cells ...
-
bioRxiv - Neuroscience 2020Quote: ... cDNA of Human Phosphodiesterase type 10 (hPDE10) was amplified by conventional nested PCR using human brain cDNA (Clontech). cDNAs template encoding wild-type and D674A mutant form of hPDE10 catalytic domain (CD ...
-
bioRxiv - Cell Biology 2020Quote: ... The 10 amino acid duplication 3’ to GFP or mCherry2 on SHH protein was introduced using Infusion (Clontech) using primers (forward 5’TCCGGCGGCAGATCTGCAGAGAACTCCGTGGCGGCCAAATCCGGCGGCTGTTTCCCGG GA and reverse 5’ tcccgggaaacagccgccggatttggccgccacggagttctctgcagatctgccgccgga) ...
-
bioRxiv - Biophysics 2021Quote: ... A total of 20 μl reaction system contains 10 μl 2X Premix Ex Taq II (TaKaRa, Dalian, China), 1 μl of 3D gene specific primer (forward ...
-
bioRxiv - Systems Biology 2022Quote: ... and deposited in 10 uL ice-cold lysis buffer containing 0.1% Triton-X 100 and RNase inhibitor (Takara) and stored at −80°C until further processing ...
-
bioRxiv - Zoology 2019Quote: ... 0.6 μL of 10 μM forward and reverse primers and 0.08 μL of 5.0U/ μL of Taq DNA polymerase (TAKARA), 1.5 μl of 10% Dimethyl sulfoxide (DMSO ...
-
bioRxiv - Neuroscience 2020Quote: ... We coated 6-8 mg of 1.6 µm gold beads with 10-15 µg of EGFP-N1 (Clontech) or 20 μg pSuper-cofilin1-shRNA + 20 μg pSuper-ADF-shRNA (Bosch et al. ...
-
bioRxiv - Plant Biology 2021Quote: ... The transcript abundance was measured in 10 µL volume of the SYBR Green PCR Master Mix (Takara, Japan) containing cDNA corresponding to 5 ng of total RNA with gene-specific primers ...
-
bioRxiv - Microbiology 2021Quote: ... 500 ng of total RNA was used in 10 μL PrimeScript™ RT Master Mix (TaKaRa, Tokyo, Japan) as described in the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... column was equilibrated with 10 column volumes of Equilibration Buffer (HisTALON™ Buffer Set, Clontech Laboratories, Cat# 635651). The filtered supernatant was loaded onto the HisTALON cartridge (Clontech Laboratories ...
-
Immunoresolvents Support Skeletal Myofiber Regeneration via Actions on Myeloid and Muscle Stem CellsbioRxiv - Immunology 2020Quote: ... High-quality RNA (10 ng, RIN>9) was used to produce cDNA libraries using SmartSeq v4 (Clontech, 634888). cDNA was prepared into sequencing libraries using 150 pg of full-length cDNA amplicons with the Illumina® Nextera XT DNA Library Preparation Kit with dual index barcodes ...
-
bioRxiv - Biophysics 2022Quote: ... 10 μL of the reaction was then transformed into 100 μL of StellarTM competent cells (Takara Bio USA) and plated on kanamycin plates ...
-
bioRxiv - Genetics 2022Quote: ... 0.1-0.2*106 mESCs were seeded per well in a 24-12-well plate in conventional ESC medium and transduced the next day with 0.25-0.5 ml of 10:1 concentrated (lenti-X, Clontech) supernatant with 8 ng/μl polybrene (Sigma Aldrich) ...
-
bioRxiv - Microbiology 2022Quote: ... 10 µg of Spike expressor and 2.5 µg of a green fluorescent protein (GFP) expressor (pIRES2-eGFP; Clontech) was transfected into 2 × 106 HEK 293T cells ...
-
bioRxiv - Neuroscience 2023Quote: All cells were cultured in high glucose DMEM with 10% Fetal Bovine Serum (tetracycline free, Clontech or Gibco) and penicillin/streptomycin 50units/ml-50 mg/ml ...
-
bioRxiv - Neuroscience 2022Quote: ... 4 uL Maxima 5x RT buffer, 0.124 uL NxGen RNAse inhibitor, 0.25 uL SUPERase In, 1 uL 10 mM Takara dNTPs ...
-
bioRxiv - Bioengineering 2023Quote: ... Samples were incubated at 42 °C for 10 min with gDNA Eraser to remove the genomic DNA (Takara). PrimeScript RT Reagent Kit was used for RNA reverse transcription and cDNA synthesis ...
-
bioRxiv - Genetics 2024Quote: ... The reaction was performed in a 20 μL reaction mixtures comprising 10 μL of 2× SYBR (TaKaRa, Japan), 1 μL of cDNA ...
-
bioRxiv - Cancer Biology 2024Quote: ... T cells were transduced using lentivirus at an MOI between 5 and 10 on Retronectin-coated (Takara, T100B) plates overnight to express an M5 or SS1 CAR ...