Labshake search
Citations for Takara Bio :
1201 - 1250 of 5216 citations for Urea Nitrogen BUN Detection Kit 10 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2024Quote: ... Libraries were prepared using SMART-Seq Stranded Kit (Takara Bio). The quality ...
-
bioRxiv - Cell Biology 2024Quote: ... cDNA was prepared using PrimeScript cDNA Synthesis Kit (DSS Takara Bio India Pvt ...
-
bioRxiv - Cell Biology 2024Quote: ... using In-Fusion® HD Cloning Kit (Takara Bio, #639650). Subsequently ...
-
bioRxiv - Physiology 2023Quote: ... The SMARTer Stranded RNA Pico Mammalian V2 kit (Takara Bio) was used to create Illumina sequencing libraries ...
-
bioRxiv - Immunology 2023Quote: ... The SMARTer Stranded RNA Pico Mammalian V2 kit (Takara Bio) was used to create Illumina sequencing libraries ...
-
bioRxiv - Genomics 2020Quote: ... 20 ng of sheared DNA was used for the library construction with ThruPLEX DNA Seq Kit and DNA HT Dual Index Kit (Takara Bio USA, Mountain View, CA). Plasma and tumor DNA libraries were sequenced using paired-end 50 bp reads generated on the NovaSeq 6000 Sequencing System (Illumina ...
-
bioRxiv - Genomics 2020Quote: The cfDNA library construction was performed with the SMARTer ThruPLEX Plasma-Seq Kit and DNA HT Dual Index Kit (Takara Bio USA, Mountain View, CA), as per manufacturer’s instructions ...
-
bioRxiv - Systems Biology 2021Quote: ... We prepared ligation-free ribosome profiling and total RNA-seq libraries from the clarified polysome lysates treated for 6 hours following the instructions provided with their respective kits (smarter-seq smRNA-seq kit, Takara-Clontech; NEBnext Ultra-Directional II) augmented with our previously-published ligation-free ribosome profiling protocol42 ...
-
bioRxiv - Biochemistry 2022Quote: ... Total RNA was isolated using RNAqueous isolation kit (Thermo-Fisher, Waltham MA) and mRNA reverse transcribed using PrimeScript RT Reagent Kit (Takara Bio USA, Mountain View CA). Quantitative PCR reactions were carried out using PowerUp SYBR-Green master mix using StepOne Real-Time PCR systems (Applied Biosystems) ...
-
bioRxiv - Plant Biology 2020Quote: ... 10 AtCBLs prey vectors were co-transformed into the yeast strain AH109 following manufacturer’s instructions (Clontech, CA, USA). The empty vectors pTOOL27 and pTOOL28 were also co-transformed into yeast with each prey or bait plasmid respectively to confirm that bait does not autonomously activate the reporter genes in the absence of the prey protein.
-
bioRxiv - Genetics 2021Quote: ... followed by a final extension at 72 °C for 10 min by using Takara Taq polymerase (Clontech, #TAKR001). To remove the DsRed cassette ...
-
bioRxiv - Microbiology 2021Quote: ... and 10 ng of Renilla luciferase (pTK r.luc) by using 4 µl of TransIT 293 (Takara, Shiga, Japan) and 100 µl of OPTI- MEM (Thermo Fisher Scientific ...
-
bioRxiv - Biophysics 2021Quote: ... and sgRNA were cultured at 37°C and 5% CO2 in high-glucose Dulbecco’s modified Eagle’s medium (DMEM, HyClone) supplemented with 10% (v/v) FBS (ClonTech), 250 µg/ml hygromycin ...
-
bioRxiv - Microbiology 2021Quote: ... 10 μg of Spike expressor and 2 μg of a green fluorescent protein (GFP) expressor (pIRES2-eGFP; Clontech) was transfected into 2 × 106 293T cells ...
-
bioRxiv - Neuroscience 2020Quote: ... cDNA of Human Phosphodiesterase type 10 (hPDE10) was amplified by conventional nested PCR using human brain cDNA (Clontech). cDNAs template encoding wild-type and D674A mutant form of hPDE10 catalytic domain (CD ...
-
bioRxiv - Cell Biology 2020Quote: ... The 10 amino acid duplication 3’ to GFP or mCherry2 on SHH protein was introduced using Infusion (Clontech) using primers (forward 5’TCCGGCGGCAGATCTGCAGAGAACTCCGTGGCGGCCAAATCCGGCGGCTGTTTCCCGG GA and reverse 5’ tcccgggaaacagccgccggatttggccgccacggagttctctgcagatctgccgccgga) ...
-
bioRxiv - Biophysics 2021Quote: ... A total of 20 μl reaction system contains 10 μl 2X Premix Ex Taq II (TaKaRa, Dalian, China), 1 μl of 3D gene specific primer (forward ...
-
bioRxiv - Systems Biology 2022Quote: ... and deposited in 10 uL ice-cold lysis buffer containing 0.1% Triton-X 100 and RNase inhibitor (Takara) and stored at −80°C until further processing ...
-
bioRxiv - Zoology 2019Quote: ... 0.6 μL of 10 μM forward and reverse primers and 0.08 μL of 5.0U/ μL of Taq DNA polymerase (TAKARA), 1.5 μl of 10% Dimethyl sulfoxide (DMSO ...
-
bioRxiv - Neuroscience 2020Quote: ... We coated 6-8 mg of 1.6 µm gold beads with 10-15 µg of EGFP-N1 (Clontech) or 20 μg pSuper-cofilin1-shRNA + 20 μg pSuper-ADF-shRNA (Bosch et al. ...
-
bioRxiv - Plant Biology 2021Quote: ... The transcript abundance was measured in 10 µL volume of the SYBR Green PCR Master Mix (Takara, Japan) containing cDNA corresponding to 5 ng of total RNA with gene-specific primers ...
-
bioRxiv - Microbiology 2021Quote: ... 500 ng of total RNA was used in 10 μL PrimeScript™ RT Master Mix (TaKaRa, Tokyo, Japan) as described in the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... column was equilibrated with 10 column volumes of Equilibration Buffer (HisTALON™ Buffer Set, Clontech Laboratories, Cat# 635651). The filtered supernatant was loaded onto the HisTALON cartridge (Clontech Laboratories ...
-
Immunoresolvents Support Skeletal Myofiber Regeneration via Actions on Myeloid and Muscle Stem CellsbioRxiv - Immunology 2020Quote: ... High-quality RNA (10 ng, RIN>9) was used to produce cDNA libraries using SmartSeq v4 (Clontech, 634888). cDNA was prepared into sequencing libraries using 150 pg of full-length cDNA amplicons with the Illumina® Nextera XT DNA Library Preparation Kit with dual index barcodes ...
-
bioRxiv - Biophysics 2022Quote: ... 10 μL of the reaction was then transformed into 100 μL of StellarTM competent cells (Takara Bio USA) and plated on kanamycin plates ...
-
bioRxiv - Genetics 2022Quote: ... 0.1-0.2*106 mESCs were seeded per well in a 24-12-well plate in conventional ESC medium and transduced the next day with 0.25-0.5 ml of 10:1 concentrated (lenti-X, Clontech) supernatant with 8 ng/μl polybrene (Sigma Aldrich) ...
-
bioRxiv - Microbiology 2022Quote: ... 10 µg of Spike expressor and 2.5 µg of a green fluorescent protein (GFP) expressor (pIRES2-eGFP; Clontech) was transfected into 2 × 106 HEK 293T cells ...
-
bioRxiv - Neuroscience 2023Quote: All cells were cultured in high glucose DMEM with 10% Fetal Bovine Serum (tetracycline free, Clontech or Gibco) and penicillin/streptomycin 50units/ml-50 mg/ml ...
-
bioRxiv - Neuroscience 2022Quote: ... 4 uL Maxima 5x RT buffer, 0.124 uL NxGen RNAse inhibitor, 0.25 uL SUPERase In, 1 uL 10 mM Takara dNTPs ...
-
bioRxiv - Bioengineering 2023Quote: ... Samples were incubated at 42 °C for 10 min with gDNA Eraser to remove the genomic DNA (Takara). PrimeScript RT Reagent Kit was used for RNA reverse transcription and cDNA synthesis ...
-
bioRxiv - Neuroscience 2023Quote: Genomic DNA was extracted from 10 whole bodies of wandering flies using MightyPrep reagent for DNA (Takara #9182). Whole body RNA was extracted from 10 whole bodies of wandering flies using TRIzol (Ambion #15596018) ...
-
bioRxiv - Cell Biology 2021Quote: ... samples were prepared for library prepraration using the SMARTer® Stranded Total RNA-Seq Kit v2 - Pico Input Mammalian Kit for Sequencing (Takara Bio USA, Mountain View, CA). Total RNA was quantified and purity ratios determined for each sample using the NanoDrop 2000 spectrophotometer (Thermo Fisher Scientific ...
-
bioRxiv - Plant Biology 2020Quote: ... Using the cDNA synthesis kit (TaKaRa: Moloney Murine Leukemia Virus Version), cDNA was synthesized from extracted RNA ...
-
bioRxiv - Biochemistry 2020Quote: ... Transfection was carried out with CalPhosTM Mammalian Transfection Kit (Takara Bio) at a ratio of pLL3.7:psPAX2:MD2G = 20:15:6 ...
-
bioRxiv - Cancer Biology 2021Quote: ... cDNA was then prepared using the PrimeScript RT reagent kit (TaKaRa). QPCR reactions were performed according to the manufacturer’s instructions using SYBR® Premix Ex Taq kit (TaKaRa) ...
-
bioRxiv - Molecular Biology 2020Quote: ... total RNAs were extracted using the RNAplus Kit (TaKaRa, Dalian, China) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... One-Step TB Green PrimeScript PLUS RT-PCR Kit (Takara Bio) was used under the following conditions ...
-
bioRxiv - Microbiology 2021Quote: ... with the high-fidelity One Step RT-PCR Kit (Takara Bio). PCR products were gel purified and cloned into the pCR4-TOPO vector using the Zero Blunt Topo Cloning Kit (Invitrogen) ...
-
bioRxiv - Microbiology 2020Quote: ... The amplicons were purified by DNA Amplification Clean Up Kit (Clontech). Amplicons were pooled in equimolar ratios prior to library preparation ...
-
bioRxiv - Microbiology 2019Quote: ... the viral RNA was purified by NucleoSpin® RNA Kit (TAKARA). Recombinant INHis proteins (300 nM ...
-
bioRxiv - Developmental Biology 2021Quote: ... Total RNA was extracted using NucleoSpin RNAII kit (Takara, Cat#740955.50). qRT-PCR was performed on 96-well optical reaction plates with one-step SYBR Green PCR master mix (Bio-Rad Laboratories ...
-
bioRxiv - Developmental Biology 2021Quote: ... and the PrimeScript RT Reagent Kit with gDNA Eraser (TAKARA BIO). Real-time RT-PCR was performed using the THUNDERBIRD SYBR qPCT Mix (TOYOBO ...
-
bioRxiv - Evolutionary Biology 2020Quote: The SMARTer Ultra Low Input RNA Kit for Sequencing v4 (Takara) was used to generate first strand cDNA from 2.5 ng UNM ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Reverse transcription was performed using a PrimeScriptTM RT reagent kit (Takara), according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2020Quote: ... Sequencing libraries were constructed using ThruPLEX DNA-seq kit (Takara R400428). Sequencing was performed as described above ...
-
bioRxiv - Genomics 2022Quote: ... This was followed by a Reverse transcription reaction (SmartScribe kit Clontech) for 1 hour at 42°C and 70°C for 15 minutes ...
-
bioRxiv - Molecular Biology 2020Quote: ... Reverse transcriptase kit and PrimeSTAR Max DNA Polymerase were from TaKaRa. RiboLock RNase Inhibitor and RNase A (10 mg/mL ...
-
bioRxiv - Molecular Biology 2020Quote: RACE assay was performed with SMARTer RACE 5’/3’ kit (Clontech) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2021Quote: ... RNA libraries were generated using the SMART-Seq Stranded Kit (Takara). This kit incorporates SMART® cDNA synthesis technology (28 ...
-
bioRxiv - Molecular Biology 2021Quote: ... Viral titer was determined using the Lenti-X GoStix kit (Takara) following the manufacturer’s recommendations