Labshake search
Citations for Takara Bio :
1251 - 1300 of 5257 citations for Human E3 Ubiquitin Protein Ligase SMURF2 SMURF2 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2022Quote: ... The SMART-seq v4 Ultra Low input RNA kit (Clontech) was used to amplify cDNA ...
-
bioRxiv - Plant Biology 2022Quote: ... cDNA was synthesised using the PrimeScript II kit (Takara Bio). Total RNA and genomic DNA from A ...
-
bioRxiv - Microbiology 2022Quote: ... using the PrimeScript RT reagent Kit with gDNA Eraser (Takara). Real-time qPCR experiments were performed as described above ...
-
bioRxiv - Molecular Biology 2022Quote: ... Synthesis of cDNA was performed using cDNA synthesis Kit (Takara). The qPCR was conducted on the Applied Biosystems instrument using the SYBR Green Master Mix ...
-
bioRxiv - Neuroscience 2023Quote: ... SMARTer Stranded Total Sample prep kit-HI Mammalian (Takara, 634875) was used to generate libraries for RNA sequencing.
-
bioRxiv - Neuroscience 2023Quote: ... or PrimeSTAR Mutagenesis Basal kit (Takara Bio Inc., Shiga, Japan): Y156V ...
-
bioRxiv - Plant Biology 2022Quote: ... using an In-Fusion HD cloning kit (Clontech Laboratories, USA). Targeting vectors were introduced into F1 sporelings of M ...
-
bioRxiv - Neuroscience 2022Quote: ... Virus titers were measured using AAV titration kit (TaKaRa/Clontech) according to the manufacturer’s instructions by determining the number of DNase Iresistant vg using qPCR (StepOne ...
-
bioRxiv - Neuroscience 2022Quote: ... Virus titers were measured using AAV titration kit (TaKaRa/Clontech) according to the manufacturer’s instructions by determining the number of DNase Iresistant vg using qPCR (StepOne ...
-
bioRxiv - Microbiology 2023Quote: ... and reverse transcribed using the PrimeScript RT reagent Kit (TaKaRa). qPCR was performed using the SYBR Green Master Mix (High ROX Premixed ...
-
bioRxiv - Genomics 2023Quote: ... DNA was extracted using the NucleoBond HMW DNA kit (Takara) per the manufacturer’s instructions with a 50 °C proteinase K incubation for 4.5 hours ...
-
bioRxiv - Microbiology 2023Quote: ... After transcribing using the In vitro Transcription T7 Kit (TaKaRa), BHK-21 cells were cotransfected with both full-length genomic and nucleoprotein gene RNA ...
-
bioRxiv - Molecular Biology 2023Quote: ... and the SYBR Premix Ex Taq kit (Takara, Shiga, Japan) was used as the reaction solution ...
-
bioRxiv - Biochemistry 2022Quote: ... restriction enzymes and DNA ligation kit ver.2 (Takara Bio); pET21a and E ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... and pLL3.7m plasmids using CalPhos mammalian transfection kit (Takara Bio). Two days following transfection ...
-
bioRxiv - Systems Biology 2022Quote: ... viruses were purified using the Retro-X Concentrator kit (Clontech) according to manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... and pAAVDJ using the In-Fusion HD Cloning kit (Clontech) and QuikChange II Site-Directed Mutagenesis Kit (Agilent) ...
-
bioRxiv - Molecular Biology 2023Quote: ... purified using NucleoSpin Gel and PCR Clean-Up Kit (Takara), cloned into pRACE vector (provided in the kit ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... PrimeScript 1st strand cDNA Synthesis Kit (Takara Bio, Shiga, Japan); PrimeScript RT-PCR Kit (Takara Bio ...
-
bioRxiv - Biophysics 2023Quote: ... were generated using In-Fusion HD Cloning kit (Clontech (TaKaRA)) following the supplier’s instructions ...
-
bioRxiv - Biophysics 2023Quote: ... were generated using In-Fusion HD Cloning kit (Clontech (TaKaRA)) following the supplier’s instructions ...
-
bioRxiv - Genetics 2023Quote: ... RT was carried out with the PrimeScript Kit from TaKaRa. Quantitative RT-PCR reactions were carried out on a Real-time PCR machine (QuantStudio 5 by Applied Biosystems) ...
-
bioRxiv - Genetics 2023Quote: ... A Guide-it IVT RNA Clean-Up Kit (Takara Bio) was used to clean up the sgRNA solution ...
-
bioRxiv - Microbiology 2023Quote: ... using an In-Fusion HD Cloning Kit (TaKaRa, Cat# Z9633N). The plasmid was amplified using NEB 5-alpha F′ Iq Competent E ...
-
bioRxiv - Molecular Biology 2023Quote: ... Transfection was done using the CalPhos mammalian transfection kit (Clontech). Alternatively ...
-
bioRxiv - Cell Biology 2023Quote: ... Total RNA was extracted using a commercial kit (Takara, Japan) in line with the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2023Quote: Total RNA was extracted using the NucleoSpin RNA Kit (Takara) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... cDNAs were synthesized using PrimeScript RT reagent Kit (Takara, Dalian) and then diluted and subjected to quantitative PCR using TransStart Green qPCR SuperMix (TransGen Biotch ...
-
bioRxiv - Genetics 2023Quote: ... cDNA was synthesized using the PrimeScript RT reagent kit (Takara) and used as templates for real-time PCR analysis using SYBR PreMix ExTaqII (Takara) ...
-
bioRxiv - Microbiology 2023Quote: ... using a DNA Ligation Kit (Mighty Mix, TaKaRa, Cat# 6023). The ligated constructs were then transformed in NEB 5-alpha F′ Iq Competent E ...
-
bioRxiv - Bioengineering 2023Quote: ... The virus titer was determined using AAVPro titration kit (Takara).
-
bioRxiv - Bioengineering 2023Quote: ... Virus titers were determined using AAVpro Titration Kit Ver2 (TaKaRa).
-
bioRxiv - Plant Biology 2023Quote: ... and standard PCR was performed using ExTaq HS kit (TaKaRa). Control reactions were run using wild-type DNA as a template.
-
bioRxiv - Genetics 2023Quote: ... and Unique Dual Index Kit (U001-U024) (Takara Bio #634756) with some modifications ...
-
bioRxiv - Immunology 2023Quote: ... and spleen tissues using an RNAiso Plus kit (Takara Bio), and subsequently reverse transcribed into cDNAs ...
-
bioRxiv - Neuroscience 2023Quote: ... using SMARTer Ultra Low Input kit (634940, Takara Bio/Clontech). All samples were sequenced in parallel using Illumina NovaSeq 6000 flow cell and fastq files have been deposited on the Gene Expression Omnibus (GEO ...
-
bioRxiv - Neuroscience 2023Quote: ... using SMARTer Ultra Low Input kit (634940, Takara Bio/Clontech). All samples were sequenced in parallel using Illumina NovaSeq 6000 flow cell and fastq files have been deposited on the Gene Expression Omnibus (GEO ...
-
bioRxiv - Neuroscience 2023Quote: ... cDNAs were prepared with SmarSeq Ultra Low input kit (Takara).
-
bioRxiv - Plant Biology 2023Quote: ... paired-ended libraries were constructed using SMART ChIPseq kit (TAKARA) and sequenced using HiseqX ...
-
bioRxiv - Neuroscience 2023Quote: ... Infusion cloning (Takara-Bio In-Fusion HD cloning Kit; 639650) was used to clone in EF1-alpha promoter generating a pAAV.U6.shRLuc.EF1-α.ZsGreen.SV40 plasmid and express ZsGreen under EF1-α promoter (Table 2) ...
-
bioRxiv - Developmental Biology 2023Quote: ... cDNA was synthesized by SMART-Seq mRNA kit (Takara, 634772). Library DNAs were prepared according to the Nextera XT DNA Library Preparation Kit (Illumina ...
-
bioRxiv - Cell Biology 2023Quote: ... using the In-Fusion ® HD Cloning Kit (Z9648N; TaKaRa).
-
bioRxiv - Microbiology 2023Quote: ... using an In-Fusion HD Cloning Kit (TaKaRa, Cat# Z9633N). Plasmids were amplified using NEB 5-alpha F′ Iq competent Escherichia coli (NEB ...
-
bioRxiv - Cell Biology 2023Quote: ... by PCR using a PrimeSTAR Mutagenesis Basal Kit (Takara, R046A) and the following primers ...
-
bioRxiv - Developmental Biology 2024Quote: ... the SMART-seq v4 Ultra Low Input RNA kit (Takara) was used to prepare cDNAs starting from 1.5 µg of total RNA for each sample and sequencing libraries were prepared subsequently prepared using the Ovation Ultralow System V2 (NuGen) ...
-
bioRxiv - Plant Biology 2024Quote: ... or the SMART-Seq mRNA LP Kit (Takara Bio USA) (for pre-parasitic J2 library generation) ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... SYBR RT-PCR Kit was purchased from Takara (Dalian, China). PHrodo-labelled E ...
-
bioRxiv - Microbiology 2024Quote: The SMARTer® RACE 5’/3’ kit (Takara Bio, USA) was used to generate cDNA according to the manufacturer’s instructions using a maPgV-specific reverse primer (TGCGAGAGCCGTCAGCCACA) ...
-
bioRxiv - Bioengineering 2024Quote: ... AAV was purified with the AAVpro Purification Kit (Takara, 6666) according to manufacturer’s instruction ...
-
bioRxiv - Biochemistry 2024Quote: ... and RNA extraction kit were bought from Takara (Dalian, China). Ultrapure water was employed throughout the work ...