Labshake search
Citations for Takara Bio :
1151 - 1200 of 1581 citations for Phospho AMPK alpha 1 S496 Rabbit Recombinant mAb since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2024Quote: ... Transfer clarified supernatant to fresh container and combine 1 volume of Lenti-X concentrator (TaKaRa; Cat.no: 631232) to 3 volumes of clarified supernatant ...
-
bioRxiv - Plant Biology 2024Quote: ... Total RNA (1 μg) was reverse transcribed into cDNA using PrimeScript RT reagent kit (Takara Bio, Japan), and expression was quantified using the TB Green® Premix Ex Taq™ II (Takara) ...
-
bioRxiv - Molecular Biology 2024Quote: ... cDNA was synthesized from 1 μg of extracted RNA per sample using the SMARTScribe reverse transcriptase (Clontech) and dT primer (GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG T30VN) ...
-
bioRxiv - Cancer Biology 2021Quote: Full-length cDNA was synthesized from total RNA (1 μg) by SMARTer®□ PCR cDNA Synthesis kit (Clontech) according to the manufacture’s instruction ...
-
bioRxiv - Cancer Biology 2021Quote: ... cDNA was obtained from 1 µg of total RNA from each sample (Super M-MLV reverse transcriptase, TAKARA) and QPCR was performed using TaqMan™ Gene Expression Master Mix (4369016 ...
-
bioRxiv - Cell Biology 2020Quote: ... 1 μg of total RNA was reverse transcribed using Takara PrimeScript™ RT Master Mix (Clontech Laboratories, USA). qRT-PCR was performed on Step One Plus Real-Time PCR System (Applied Biosystems ...
-
bioRxiv - Neuroscience 2021Quote: ... Sections were then stained using primary antibodies against the reporter proteins mCherry (Clontech 632543 RRID: AB_2307319, 1:250) and against the panneuronal marker NeuN (millipore MAB377 RRID ...
-
bioRxiv - Immunology 2019Quote: ... cDNA was generated from 1 μg of RNA using the PrimeScript RT reagent kit with gDNA Eraser (Takara). The mRNA quantifications of target genes were performed by real-time PCR using the SYBR GREEN MIX (Takara) ...
-
bioRxiv - Cell Biology 2019Quote: Chimeras 1-5 were first generated in pBluescript by In-Fusion cloning (Takara Bio, USA, Mountain View, CA) of inserts encoding different fragments of human Myo1e PCR-amplified from pEGFP-C1-myo1e-EcoR1-into the PCR-amplified segments of pBS-SpMyo1 vector using primers designed to replace selected SpMyo1 domain sequences with corresponding HsMyo1e sequences ...
-
bioRxiv - Microbiology 2019Quote: ... the total RNA (1 µg) was reverse transcribed by PrimeScript RT reagent Kit with gDNA Eraser (Takara, China). The IL-1β and components of RISC mRNA expression levels of the NA cells were quantified with the SYBR Green qPCR kit (Takara ...
-
bioRxiv - Genetics 2019Quote: ... all other experiments with yeast were carried out according to standard protocols (Clontech Yeast Protocol Handbook, PT3024-1).
-
bioRxiv - Neuroscience 2021Quote: ... The plasmid called “CFP-Golgi” (containing amino acids 1–81 of ß-1,4glycosyltransferase) was originally purchased from Clontech.
-
bioRxiv - Systems Biology 2021Quote: ... Other plasmid components (see Supplementary Table 1) were synthesized or PCR amplified with PrimerSTAR MAX DNA polymerase (TAKARA) and checked by Sanger sequencing ...
-
bioRxiv - Synthetic Biology 2021Quote: ... The cDNA was synthesized from 1 μg of total RNA using the PrimeScript™ RT-PCR Kit (Takara). Three technical replicates were measured for gene expression levels in each cDNA sample ...
-
bioRxiv - Molecular Biology 2021Quote: ... 1 μg each CAS9 guide RNA plasmid (pAS4883 and 4884) and 200 ng linear hygromycin resistance gene (Clontech) were used ...
-
bioRxiv - Microbiology 2021Quote: ... pAS1b-HA-TAROR (1-931) or pAS1b-HA-TASOR (630-1512) have been constructed by InFusion technology (Takara) according to the kit manufacture guide ...
-
bioRxiv - Cell Biology 2021Quote: ... First-strand cDNA was synthesized by reverse transcription of 1 μg RNA using PrimeScrip RT Master Mix(Takara). Quantitative real time-PCR was performed using TB Green Premix Ex Taq (Takara ...
-
bioRxiv - Cell Biology 2021Quote: ... Reverse transcription reactions containing 1 μg of total RNA were performed using PrimeScript™ (Takara, Otsu, Shiga, Japan). Individual cDNAs were amplified with THUNDERBIRD™ SYBR qPCR Mix (TOYOBO CO ...
-
bioRxiv - Microbiology 2022Quote: ... KSHV replication in iSLK/Bac16 cells was reactivated by a combination of 1 μg/ml doxycycline (DOX, Clontech) and 1 mM sodium butyrate (Bu ...
-
bioRxiv - Plant Biology 2021Quote: ... cDNA synthesis was performed with 1 μg of total RNA using the PrimeScript™ RT Reagent Kit (Takara) following the manufacturer’s instructions ...
-
bioRxiv - Genetics 2022Quote: cDNA was generated from 1 μg of total RNA by using the PrimeScript RT Reagent Kit (Takara, Japan) in accordance with the manufacturer’s protocol as previously described [21] ...
-
bioRxiv - Bioengineering 2019Quote: Splinkerette PCR (spPCR) was done on genomic DNA from Klg-1 mESCs using Primestar HS mastermix (Takara R040) and primers specific for the inverse terminal repeats of the piggyBac sequences flanking the immunomodulatory transgenes ...
-
bioRxiv - Cell Biology 2020Quote: The N-terminal domain of dTBCE (amino acid 1 to 207) was cloned using the Infusion system (Takara) into pET23B (Clontech ...
-
Airway Gene-Expression Classifiers for Respiratory Syncytial Virus (RSV) Disease Severity in InfantsbioRxiv - Immunology 2020Quote: ... 1 ng of total RNA was amplified using the SMARter Ultra Low amplification kit (Clontech, Mountain View, CA) and libraries were constructed using the NexteraXT library kit (Illumina ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: cDNA was reverse-transcribed from 1 μg of total RNA using PrimeScript RT reagent (TaKaRa Biotechnology, Shiga, Japan), and 10 ng of cDNA was analyzed using SYBR Premix Ex Taq II (TaKaRa Biotechnology ...
-
bioRxiv - Molecular Biology 2020Quote: ... the plug was incubated in 160 μl of 1× M buffer containing 160 units of Nhe I (TaKaRa) for 7 hr at 37°C ...
-
bioRxiv - Microbiology 2020Quote: ... 1 μg of RNA was reverse-transcribed to synthesize complementary DNA by using reverse transcriptase (Takara Bio, Japan) and random hexamer primers ...
-
bioRxiv - Developmental Biology 2020Quote: ... 1×106 E14 ESCs were transfected with the two appropriate pSPCAs9(Guide)-2A-mCherry vectors using Xfect (Clontech). 48 hours after transfection cells were sorted for high levels of mCherry expression and plated onto 10 cm gelatinized dishes ...
-
bioRxiv - Genetics 2019Quote: RNA-seq libraries were prepared from 1 ng of total RNA using the SMART-Seq HT Kit (Takara) combined with Nextera XT kit (Illumina) ...
-
bioRxiv - Cancer Biology 2022Quote: ... and 1 ng of RNA was used for the reverse transcription reaction using SMART-seq HT (Takara, 634455). For the PDO xenograft ...
-
bioRxiv - Genetics 2022Quote: ... 0.1-0.2*106 mESCs were seeded per well in a 24-12-well plate in conventional ESC medium and transduced the next day with 0.25-0.5 ml of 10:1 concentrated (lenti-X, Clontech) supernatant with 8 ng/μl polybrene (Sigma Aldrich) ...
-
bioRxiv - Molecular Biology 2022Quote: ... cells were first lysed in ice-cold lysis buffer (1×PBS, 0.5% sodium deoxycholate, 0.1% SDS, 0.5% NP40) with RNase inhibitor (Takara, 2313) and a protease inhibitor (Solarbio ...
-
bioRxiv - Microbiology 2022Quote: ... The coding sequence of enhanced green fluorescent protein (eGFP) was amplified from plasmid eGFP-C1 (6084-1, Clontech) using primers eGFPN-F/eGFPN-R ...
-
bioRxiv - Neuroscience 2022Quote: ... 4 uL Maxima 5x RT buffer, 0.124 uL NxGen RNAse inhibitor, 0.25 uL SUPERase In, 1 uL 10 mM Takara dNTPs ...
-
bioRxiv - Physiology 2022Quote: ... The insulin-like growth factor 1 (IGF1) coding sequence was PCR amplified (CloneAmp, Takara Bio; Cat. No. 639298) from cDNA generated from a rat gastrocnemius muscle ...
-
bioRxiv - Plant Biology 2024Quote: ... The PLT2-GFP fusion protein abundance was detected by using anti-GFP (cat#632381, 1:3,000 dilution; Clontech) and anti-ACTIN (cat#MA1-744 ...
-
bioRxiv - Neuroscience 2024Quote: ... and BFP/FAT-1/FAT-2 and T2A-NLS-mApple fragments were inserted with InFusion cloning (Takara Bio), as per manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2024Quote: ... 0.6 μl PCR mix was dispensed to each well containing the following: 1× SeqAmp PCR buffer (Takara Bio), 0.025 U μl−1 of SeqAmp polymerase (Takara Bio ...
-
bioRxiv - Neuroscience 2024Quote: ... They were transfected with pAAV, pAAV2/1 (Penn Vector Core, Philadelphia, PA, USA) and pHelper plasmids (Takara Bio)52 ...
-
bioRxiv - Cell Biology 2024Quote: ... the membranes were incubated with a 1:2000 dilution of an anti-GFP antibody (Clontech 632381, clone JL8) for detection of Clover protein ...
-
bioRxiv - Biochemistry 2022Quote: ... coli codon optimized CHAF1A cDNA was first cloned into a pGEX-6P-1 vector via In Fusion (Takara) (Supplementary Table 3) ...
-
bioRxiv - Immunology 2023Quote: ... and 1 µg was used for cDNA synthesis with the PrimeScript High Fidelity RT-PCR Kit (Takara, R022B). Of the cDNA ...
-
bioRxiv - Plant Biology 2023Quote: ... cDNA was synthesized using 1 µg of RNA following manufacturers’ instruction (1st strand cDNA synthesis kit, Takara; 6110A). RT-PCR was performed using SapphireAmp® Fast PCR Master Mix (Takara ...
-
bioRxiv - Genomics 2023Quote: ... Primary antibodies were diluted in 5% milk in PBS-T + 0.01% sodium azide (1:2,000 for mouse anti-GFP (Clontech) and mouse anti-3V5 (Invitrogen) ...
-
bioRxiv - Microbiology 2023Quote: The pEGFP-C1 plasmids including AFF4 3’UTR sites “1-2-3” were generated using pEGFP-C1 (Clontech). The following complementary oligonucleotides were annealed in respective pairs as above (1.25 µM each in 75 mM NaCl ...
-
bioRxiv - Cancer Biology 2022Quote: ... filtered through 0.45 μm syringe filters (Starlab) and concentrated using 1/3 volume of Lenti-X concentrator (Clontech) as per the manufacturer’s instructions ...
-
bioRxiv - Immunology 2023Quote: Non-tissue culture treated 12-well plates were coated overnight at 4°C with 1 ml Retronectin (Takara) at 25 μg/ml in PBS ...
-
bioRxiv - Genomics 2023Quote: ... 100 ng to 1 µg of total RNA was used for Hi-Mammalian whole transcriptome preparation (Takara Bio) and sequencing was performed on Nextseq2000 instrument with 1 x 72 bp single-end setup ...
-
RNA-binding protein YBX1 promotes Type H vessels dependent bone formation in an m5C-dependent mannerbioRxiv - Molecular Biology 2023Quote: ... The paraffin sections were de-waxed and stained with primary antibody OCN (#M173, Takara Bio, Japan, 1:100), and counterstained with Harris Hematoxylin.
-
bioRxiv - Plant Biology 2023Quote: The full-length MpACL5 amplified from Tak-1 cDNA by PCR using TaKaRA EX Taq (Takara, Shiga, Japan) with the primers ...