Labshake search
Citations for Takara Bio :
1001 - 1050 of 1258 citations for tert Butyl 3 5 2 amino ethyl thiophen 3 yl propionate since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2024Quote: ... the 5 μl samples were used as input into the SMART-Seq v4 Ultra Low Input RNA Kit (Takara Bio USA) (for parasitic J3 library generation ...
-
bioRxiv - Molecular Biology 2024Quote: ... fragmented RNA library was mixed with 5 µM of PE2-N6 primer (Supplementary Table S1) and reverse transcribed using PrimeScript RTase (Takara, SD0418) for 60Lmin at 42L°C ...
-
bioRxiv - Neuroscience 2023Quote: ... 5 μL of treated RNA was reverse transcribed using oligo d(T) primers (PrimeScript RT Reagent Kit, Takara Bio, Kyoto Japan). Then ...
-
bioRxiv - Biophysics 2024Quote: ... The supernatant was then diluted 1:5 to improve binding efficiency and incubated overnight on the rotisserie at 4°C with TALON Cobalt Resin (Takara Bio). The next day the resin was washed with 10 column volumes of Membrane Buffer 1 ...
-
bioRxiv - Microbiology 2023Quote: ... lytic-induced or uninduced cells (5×105 cells on a 6-well plate) were harvested with 500 μL of RNAiso Plus (Takara Bio). Total RNA was extracted ...
-
bioRxiv - Cell Biology 2023Quote: RACE-ready (Rapid Amplification of cDNA 5’ Ends) cDNA was generated using SMARTer PCR cDNA Synthesis Kit (#634925, Clontech Laboratories, Inc.) according to the manufacturer’s protocol.
-
bioRxiv - Microbiology 2023Quote: ... as previously described (17): pcDNA3.1+-based plasmids used for ectopic expression and pRetroX-tight-Puro-based ones (Clontech, cat. PT3960-5) used here to generate stable cell lines expressing ISG20 upon induction with doxycycline (dox.) ...
-
bioRxiv - Plant Biology 2023Quote: ... 5′ Rapid amplification of cDNA ends (RACE) was performed using the primer-R5 (Supplemental Table 5S) with the 5′ Full Race Core kit (TAKARA, Japan). The bioinformatics analysis of CcSHMT1 sequences show in Supplemental marterial ...
-
bioRxiv - Synthetic Biology 2023Quote: ... VH and VL segments were ordered as gene blocks from Integrated DNA Technologies and were cloned into linearized CMV/R backbones with 5× In-Fusion HD Enzyme Premix (Takara Bio).
-
bioRxiv - Genetics 2023Quote: First-strand cDNA was synthesized from 5 μg of total RNA using the PrimeScriptTMII cDNA Synthesis kit from Takara (https://takara.com/). The full-length cDNAs of SUH1 and BC10 were amplified using the Taq LA DNA polymerase PCR kit from Takara (https://takara.com/ ...
-
bioRxiv - Molecular Biology 2024Quote: ... plasmid and cloned within exon 4 (between base 43-44) and exon 5 (between base 71-72) of the circ-HDGFRP3 sequence by In-Fusion Cloning Kit (Takara Bio) to obtain the final constructs p-circ-Ex4 and p-circ-Ex5.
-
bioRxiv - Plant Biology 2024Quote: ... The coding sequences (CDS) of the full length and truncated Sr62NLR were cloned into pGADT-7 vector (Clontech, USA, PT3249-5) with the sites EcoRI and BamHI ...
-
bioRxiv - Immunology 2024Quote: ... containing 0.5 ml of a 1:1 solution of phosphate-buffered saline (PBS):FBS supplemented with ribonuclease inhibitor (1:100; Takara Bio). For some samples ...
-
bioRxiv - Developmental Biology 2021Quote: ... 0.3 μM gene-specific forward/reverse primers and 2 μL of diluted cDNA using a thermal cycler Dice (Takara). The reactions were carried out as follows ...
-
bioRxiv - Molecular Biology 2021Quote: ... Methylated and non-methylated DNA fragments were separated using the EpiXplore Methylated DNA Enrichment Kit (Clontech, cat# PT5034-2). Libraries were generated using the DNA SMART ChIP-Seq Kit (Takara ...
-
bioRxiv - Cell Biology 2021Quote: ... PCR was performed using 1–2 μL of the genomic DNA solution and Tks Gflex DNA polymerase (Takara Bio). The primers are listed in Table S3 ...
-
bioRxiv - Plant Biology 2020Quote: ... Approximately 2 μg of total RNA was reverse-transcribed using PrimeScript™ RT reagent Kit with gDNA Eraser (TaKaRa). Real-time quantitative RT-PCR was performed with TB Green Premix Ex Taq™ (TakaRa ...
-
bioRxiv - Neuroscience 2021Quote: ... 10 μM ROCK inhibitor (Y-27632; Selleckchem, Cat. No. S1049) and 2 μg/mL doxycycline (Clontech, Cat. No. 631311). Media was changed daily during this stage.
-
bioRxiv - Microbiology 2021Quote: ... CPER mixtures contained 0.1 pmol of each DNA fragment and 2 µl of PrimeStar GXL DNA polymerase (Takara, Japan) in a total reaction volume of 50 µl ...
-
bioRxiv - Cell Biology 2021Quote: ... The culture was split into two 2-mL cultures of which one was supplemented with 250 nM rapalog (Clontech). Parasite growth was determined via flow cytometry over five days as described above ...
-
bioRxiv - Biophysics 2022Quote: ... The supernatant was clarified by centrifugation (292,055 g, 60 min, 4°C) and bound to 2 ml of TALON IMAC resin (Clontech) overnight with 10 rpm rotation in the presence of 20 mM imidazole and NaCl added up to 800 mM ...
-
bioRxiv - Microbiology 2022Quote: The recombinant pGBKT7-TaPHB-1 was transformed into Y2HGold yeast strain following the Yeastmaker Yeast Transformation System 2 (TaKaRa). The transformants were screened on SD/-Trp agar plate ...
-
bioRxiv - Cell Biology 2022Quote: ... The yeast was transformed with the indicated plasmids using the Matchmaker™ Yeast Transformation System 2 (Clontech, Cat#: 630439). Two plasmids containing simian virus (SV ...
-
bioRxiv - Microbiology 2022Quote: The plasmids of the SARS-CoV-2 cDNA library as cloned in the pLVX-EF1alpha-IRES-Puro (Takara/Clontech) vector were a kind gift from Prof ...
-
bioRxiv - Microbiology 2022Quote: The plasmids of the SARS-CoV-2 cDNA library as cloned in the pLVX-EF1alpha-IRES-Puro (Takara/Clontech) vector were a kind gift from Prof ...
-
bioRxiv - Cell Biology 2021Quote: ... HUVECs were maintained in Endothelial Cell Basal Medium 2 supplemented with Endothelial Cell Growth Medium kits (C22211, C22111, Takara). For replating cells ...
-
bioRxiv - Immunology 2021Quote: ... His-tagged NTD domain constructs were purified from clarified supernatants using 2 ml of cobalt resin (Takara Bio TALON), washing with 50 column volumes of 20 mM HEPES-HCl pH 8.0 and 150 mM NaCl and eluted with 600 mM imidazole ...
-
bioRxiv - Immunology 2020Quote: ... and a primer (1μM final concentration) binding to the introduced SMARTER oligonucleotide (CTAATACGACTCACTATAGGGC) using the Advantage 2 PCR kit (Clontech) in a 50μl reaction ...
-
bioRxiv - Biochemistry 2022Quote: ... and ligated into the multiple cloning site 2 (MCS2) of the pTRE3G-BI vector (Clontech, Mountain View, CA, USA), resulting in the construct pTRE3G-BI/GPR83-LgBiT ...
-
bioRxiv - Bioengineering 2022Quote: ... RNA (2 µg) was reverse transcribed into cDNA with the RT Reagent Kit with gDNA Eraser (Takara, Japan, RR047A). qPCR was performed using a SYBR Premix Ex Taq kit (Takara ...
-
bioRxiv - Microbiology 2023Quote: ... or Omicron variant (G339D) using a SARS- CoV-2 Direct Detection RT-qPCR Kit (TaKaRa Bio Inc., Shiga, Japan) with each specific primer/probe ...
-
bioRxiv - Molecular Biology 2022Quote: ... one subjected to RT-PCR using PrimeScript™ One Step RT-PCR Kit Ver.2 (Dye Plus) (Takara, Japan), then the region between S-5’UTR and N protein-ORF genes was amplified to monitor the expression of eGFP.
-
bioRxiv - Neuroscience 2024Quote: ... in BrainPhys neuronal media (composed according to Bardy et al. 2015)74 and 2 µg/ml doxycycline (Takara 631311). Three days after plating and ...
-
bioRxiv - Molecular Biology 2024Quote: ... cDNA encoding FLAG-Rhino was cloned into pPB-2× Ty1-Tjen-EGFP-P2A-BlastR51 using In-Fusion cloning (TAKARA), bearing pPB-FLAG-Rhino-Tjen-EGFP-P2A-BlastR ...
-
bioRxiv - Plant Biology 2023Quote: ... Approximately 2.6 x 106 yeast transformants were screened on 2% SD/Gal/Raf/X-P-gal (-Ura/-His/-Trp/-Leu) following the manufacturer’s instructions (Clontech). Direct protein-protein interaction was confirmed by co-transformation of the respective plasmids into the yeast strain AH109 using the Matchmaker GAL4 Two-hybrid System (Clontech) ...
-
bioRxiv - Plant Biology 2023Quote: ... Yeast transformation was performed as described in the Yeastmaker Yeast Transformation System 2 User Manual (Clontech, TaKaRa Bio, USA). Serial dilution of transformed colonies were dropped on –Trp/-His synthetic dropout selection medium ...
-
bioRxiv - Plant Biology 2023Quote: ... Yeast transformation was performed as described in the Yeastmaker Yeast Transformation System 2 User Manual (Clontech, TaKaRa Bio, USA). Serial dilution of transformed colonies were dropped on –Trp/-His synthetic dropout selection medium ...
-
bioRxiv - Genetics 2023Quote: ... The transformation process followed the protocol described in the Yeastmaker™ Yeast Transformation System 2 User Manual (Takara Bio), yielding approximately 2 × 106 and 7 × 106 transformants for LE9 and BLX strains ...
-
bioRxiv - Developmental Biology 2022Quote: ... followed by the addition of 2.8 μL quenching buffer (0.7 μL of Triton X-100 [Nacalai Tesque], 0.7 μL of 2% bovine serum albumin [BSA] [Takara Bio]) and incubation at 70°C for 90 sec to quench the denaturing effect of SDc ...
-
bioRxiv - Molecular Biology 2023Quote: ... and then used as the template to synthesize double strand cDNA amplicons by PCR (optimal 17 – 21 cycles) using Advantage 2 PCR kit according to the manufacturer’s specifications (Clontech). cDNA was purified using NucleoSpin Gel and PCR Clean-up kit (Takara Bio) ...
-
bioRxiv - Microbiology 2023Quote: ... the nine pmW118 plasmid vectors were subjected to amplification of the cDNA fragments (F1-F9-10) of SARS-CoV-2 XBB.1 and XBB.1.5 by PrimeSTAR GXL DNA polymerase (Takara) with the primer sets24 ...
-
bioRxiv - Cancer Biology 2023Quote: ... His-TEV tagged protein was captured with Co-TALON resin (Clonetech, Takara Bio USA, 2 mL slurry/liter culture) at 4 ºC for 1 h with constant end-to-end mixing ...
-
bioRxiv - Biochemistry 2023Quote: ... The membrane was incubated for 1 h at room temperature with Odyssey blocking buffer and 0.2 % PBS-T (PBS containing 0.2 % (v/v) Tween-20) with rat anti-HA clone 3F primary antibody (Clontech) at 1:1,000 dilution ...
-
bioRxiv - Microbiology 2024Quote: ... The protein-bead mixtures were then loaded onto a gravity column (TALON 2 mL Disposable Gravity Column, Takara #635606). Lysate was loaded into the column 5 times with gravity flow and then washed in a 1M NaCl buffer 3 times ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... CHO-K1 cells were transiently co-transfected with 2 µg KV4.3 (cloned into pBK- CMV vector, amplified by PCR and ligated into pmCherry-C1 (Clontech), by using XhoI and HindIII restriction sites,23 and 1 µg KChIP2 (cloned into IRES mCherry KChIP2 using XbaI and XhoI restriction sites).
-
bioRxiv - Synthetic Biology 2024Quote: ... followed by incubation at 37°C for 1 hour with 2 µl of Klenow Fragment (Takara Bio Inc, Japan) and inactivation at 65°C for 5 minutes ...
-
bioRxiv - Developmental Biology 2021Quote: ... Pdum-Lox2 and Avi-Post2 the SMART™ (Switching Mechanism At 5’ end of the RNA Transcript) RACE method (SMART™ RACE cDNA amplification kit, Clontech) was used (Brena et al. ...
-
bioRxiv - Immunology 2021Quote: TCR cDNA libraries for high-throughput sequencing were prepared by 5’rapid amplification of cDNA ends (RACE) using the SMARTScribe™ Reverse Transcriptase (Clontech, USA) as previously described (39 ...
-
bioRxiv - Neuroscience 2021Quote: ... ESCs were seeded at 1 × 105 cells per well and maintained at 37°C in 5% CO2 under humidified conditions with a 3i culture medium (Y40010, Takara Bio, Japan) without feeder cells ...
-
bioRxiv - Biochemistry 2021Quote: ... RNC 82-aa C34A with [SG]5 or [SG]10 repeats were constructed by the Prime STAR MAX (Takara Bio Inc., Japan) method using appropriate primers (Table 1).