Labshake search
Citations for Takara Bio :
851 - 900 of 1258 citations for tert Butyl 3 5 2 amino ethyl thiophen 3 yl propionate since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2021Quote: ... AAV6 vector genomes were titrated by ITR-specific quantitative PCR (Takara AAVpro Titration Kit Ver.2) per the manufacturer’s protocol.
-
bioRxiv - Immunology 2022Quote: ... and treated with Exonuclease I (New EnglandBiolabs) before amplification by the Advantage 2 PCR kit (Clontech) and the SINGV6 primer (95°C for 1 min ...
-
bioRxiv - Plant Biology 2023Quote: ... and gametandiopore of one-month-old Tak-1 and Tak-2 by NucleoSpin RNA Plant (Takara) or Monarch Total RNA Miniprep Kit (New England BioLabs ...
-
bioRxiv - Biochemistry 2023Quote: ... LayV G was purified from clarified supernatants using 2 mL of cobalt resin (Takara Bio TALON), washing with 200 column volumes of 50 mM Tris-HCl pH 8.0 ...
-
bioRxiv - Developmental Biology 2023Quote: Yeast two-hybrid assays were performed according to the Yeastmaker Yeast Transformation System 2 manual (Clontech). The yeast strain AH109 was co- transformed with an AD-fused and a BD-fused construct using the lithium acetate method ...
-
bioRxiv - Immunology 2022Quote: ... SARS-CoV-2 RBDs were purified using a Cobalt affinity column (HisTALON Superflow column from Takara or HiTrap TALON crude column from Cytiva ...
-
bioRxiv - Developmental Biology 2024Quote: ... The samples were stained with anti-mouse E-cadherin monoclonal antibody ECCD-2 (1:100, Takara) for 16 h at 4°C ...
-
bioRxiv - Cancer Biology 2024Quote: ... 2 μg of genomic DNA was used as a template using Titanium Taq PCR kit (Takara). The sequence information for the primers used for barcode amplification was kindly provided by Novartis and can be found in Supplementary Table 4 ...
-
bioRxiv - Microbiology 2024Quote: ... UMI-tagged spike gene cDNA was amplified using the Advantage 2 PCR kit (Takara Bio, 639206) with forward primer TTCGCATGGTGGACAGCCTTTGTT and reverse primer CCGCTCCGTCCGACGACTCACTATA under the following thermocycling conditions ...
-
bioRxiv - Molecular Biology 2023Quote: ... or 100 ng of genomic DNA was amplified with Advantage GC 2 polymerase (Takara Bio 639114) using 1 M GC Melt and primers spanning the region from upstream of the splice donors to the 3’ end of the repeat ...
-
bioRxiv - Molecular Biology 2022Quote: ... Yeast transformation was performed according to the Yeastmaker Yeast Transformation System 2 User Manual (Clontech, Japan). The primers used are listed in Supplemental Table S1.
-
bioRxiv - Plant Biology 2022Quote: ... bHLH39-1 and bHLH39-2 fused to the BD were co-transformed into yeast Y2HGold (Clontech). Transformants were grown on SD-Leu-Trp plates ...
-
bioRxiv - Cancer Biology 2023Quote: ... 2 μg of RNA was converted to cDNA using PrimeScript 1st Strand cDNA Synthesis Kit (TaKaRa) in SureCycler 8800 (Agilent Technologies) ...
-
bioRxiv - Cell Biology 2023Quote: ... Second strand synthesis and PCR amplification was performed by adding the Advantage 2 Polymerase Mix (Clontech) and the SINGV6 primer (10 pmol ...
-
bioRxiv - Plant Biology 2024Quote: ... First-strand cDNA was synthesized using 2 μg RNA and PrimeScript RT Master Mix (Takara Bio). qRT-PCR was performed using the first-strand cDNAs diluted 5-fold in water and KAPA SYBR FAST qPCR Master Mix (2x ...
-
bioRxiv - Cancer Biology 2024Quote: ... Viral supernatant was collected 2 days post-transfection and concentrated using Lenti-X lentivirus concentrator (Clontech). Cells were then infected with the concentrated lentivirus ...
-
bioRxiv - Plant Biology 2024Quote: ... The 20-ml reaction mixture contained 10 ml of 2× TB Green Premix Ex Taq (Takara), 2 ml of diluted complementary DNA (1:5) ...
-
bioRxiv - Molecular Biology 2024Quote: ... Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix (Clontech) and the SINGV6 primer (10 pM ...
-
bioRxiv - Bioengineering 2024Quote: ... 500 ng of RNA was mixed with 2 μl of PrimeScriptTM RT reagent kit (TaKaRa, RR037B) and distilled water (DW ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... The supernatant was applied to 2 mL slurry of TALON Metal Affinity Resin (Takara Bio #635504) and nutated for 1 hour to allow TALON to bind the His tagged protein ...
-
bioRxiv - Genomics 2020Quote: The amplified library was then recombined with pCMV FAS wt minigene exon 5-6-7 (Förch et al., 2000) using the In-Fusion HD Cloning kit (639649, Clontech) in a 1:8 vector:insert optimized ratio and transformed into Stellar competent cells (636766 ...
-
bioRxiv - Developmental Biology 2020Quote: ... and mCherry were isolated by PCR from various templates and inserted into the pGL4.23-(C120×5)-TATA vector with In-Fusion cloning (Clontech) according to manufacturer instructions using a 1:2 vector-to-insert ratio to generate optogenetic response plasmids ...
-
bioRxiv - Cancer Biology 2020Quote: ... 105 tumor cells in 6-well culture vessels were transfected with 5 μg DNA using XFect (Takara, Kusatsu, Japan) and clones were selected by puromycin (2-10 μg/mL).
-
bioRxiv - Microbiology 2022Quote: ... The 5’ end regions of MIC14 and MIC15 were amplified using the SMART RACE cDNA Amplification Kit (Clontech BD) using total or poly(A)+tachyzoite RNA (strain RH ...
-
bioRxiv - Molecular Biology 2022Quote: ... bound RNAs were eluted via 30min incubation at 55°C in wash buffer supplemented with 0.5 μg/μL Proteinase K and 0.1% SDS and isolated using Qiazol/chloroform separation and NucleoSpin RNA columns (Takara). Luciferase control RNA is spiked in to each sample (5ng/sample ...
-
bioRxiv - Biochemistry 2021Quote: ... prepared as described above was mixed with imidazole (5 mM) and 0.5 mL of Talon superflow metal affinity resin (Clontech) that had been equilibrated with buffer (as above for magnetic agarose) ...
-
bioRxiv - Genomics 2022Quote: ... IgG and IgM 5’RACE AIRR-seq libraries were generated using the SMARTer Human BCR Profiling Kit (Takara Bio), following the manufacturer’s instructions ...
-
bioRxiv - Genomics 2021Quote: ... or SL medium (for E14-STNΔTsixP) and transduced the next day with 1ml of 5:1 concentrated (lenti-X, Clontech) and filtered viral supernatant with 8 ng/µl polybrene (Sigma Aldrich) ...
-
bioRxiv - Immunology 2021Quote: ... The supernatants were collected and applied to a column filled with 5 ml of TALON Metal Affinity resin (Takara) previously equilibrated with ice-cold PBS ...
-
bioRxiv - Immunology 2021Quote: ... 100,000 cells were sorted into 200 uL PBS with 1 uM DTT and 5 uL RNase Inhibitor Cocktail (Takara); for ex vivo culture experiments ...
-
bioRxiv - Neuroscience 2021Quote: ... 5’ UTR and EGFPd2 sequences were cloned in the multiple cloning site of pTet-One vector (Takara-Clontech, 634301). DG NSC Droshafl/fl cells were brought in suspension by incubating with 0.25% trypsin (Gibco #15090 ...
-
bioRxiv - Neuroscience 2021Quote: ... 5’ UTR and EGFPd2 sequences were cloned in the multiple cloning site of pTet-One vector (Takara-Clontech, 634301). DG NSC Droshafl/fl cells were brought in suspension by incubating with 0.25% trypsin (Gibco #15090 ...
-
bioRxiv - Microbiology 2022Quote: ... A 5 µl aliquot was removed from each sample for immunoblots using mouse anti-GFP (1:5,000, Clontech #632381) to detect A3-EGFP ...
-
bioRxiv - Microbiology 2022Quote: ... 10 μl of the reaction mixture was prepared with 5 μl of SapphireAmp Fast PCR Master Mix (Takara #RR350B), 1 μl of each of forward and reverse primers (final concentration 0.2 μM) ...
-
bioRxiv - Neuroscience 2023Quote: ... A total of 100 microglia from each region were collected in 5 μL single-cell lysis buffer (635013, Takara), and flash-frozen on dry ice.
-
bioRxiv - Plant Biology 2024Quote: ... RT-qPCR analysis was then performed with 1.0 μl of 5-fold diluted cDNA using a SYBR premixed Ex Taq kit (Takara), and a Light Cycler 480 Real-Time PCR System (Roche ...
-
bioRxiv - Immunology 2024Quote: ... The lysate was incubated at 37°C for 5 min and subjected to IMAC purification using TALON beads (Clontech). The eluate was concentrated by ultrafiltration using 10 kDa cut-off Vivaspin (Sartorius ...
-
bioRxiv - Genetics 2024Quote: ... The lysate was centrifuged at 35,000 rpm for 45 mins and the supernatant was applied to 5 ml Talon resin (Takara) equilibrated with the binding buffer (25 mM Tris-HCl [pH7.5] ...
-
bioRxiv - Immunology 2020Quote: Levels of p24 antigen in the purified SARS-CoV-2 pseudotype solution was measured by ELISA (Takara). Mouse sera were heat inactivated ...
-
bioRxiv - Cell Biology 2021Quote: ... DNA was amplified from WT genomic DNA by PCR using Advantage 2 Polymerase (#639202, Takara Bio, USA). Plasmid backbones were double-digested with the necessary restriction enzymes and purified using the Qiagen DNA purification kit (#28704X4 ...
-
bioRxiv - Cell Biology 2021Quote: ... 50% fresh RPMI medium supplemented with 20 U/ml IL-2 and spin-fected on RetroNectin (Takara)-coated plates at 3000 g at 32°C for 2 h ...
-
bioRxiv - Physiology 2021Quote: ... 2 µL of the synthesized cDNA was mixed with SYBR Premix Ex Taq II (Takara Bio Inc.) and 0.4 µM primers (same as above ...
-
bioRxiv - Molecular Biology 2022Quote: ... the JAK3 open reading frame was amplified by PCR using the Advantage 2 polymerase mix (Takara Bio) with JAK3-ORF primers (Table 1 ...
-
bioRxiv - Microbiology 2022Quote: ... Make Your Own “Mate & Plate™” Library System and Yeast Transformation System 2 were purchased from TaKaRa. Synthetic-defined (SD ...
-
bioRxiv - Immunology 2021Quote: ... Synthesis of cDNA was performed by using 2 μg of total RNA with PrimeScriptTM Reverse Transcriptase (Takara) according to the manufacturer’s instructions ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... SARS-COV-2 virus detection was performed using the One Step PrimeScript RT-PCR kit (TaKaRa, Japan) on the LightCycler 480 Real-Time PCR system (Roche ...
-
bioRxiv - Plant Biology 2020Quote: ... The 20-µL reaction volume comprised 10 µL 2× SYBR Green PCR Master Mix (Takara, Dalian, China), 0.2 µM each primer ...
-
bioRxiv - Immunology 2020Quote: ... the DNA-amplicons for Illumina sequencing were generated by using Advantage 2 PCR Kit (TAKARA Bio Europe), employing a mTCRβ reverse primer and a Universal primer mix (UPM) ...
-
bioRxiv - Cell Biology 2022Quote: ... full-length GIP-2 cDNA with a C-terminal V5-His6 tag was inserted into pColdI (TAKARA) and used to inoculate rabbits and rats ...
-
bioRxiv - Cell Biology 2023Quote: ... Yeast 2-hybrid (Y2H) analysis was performed using the protocols described in the Yeast protocols handbook (Clontech, Protocol No ...