Labshake search
Citations for Takara Bio :
51 - 100 of 604 citations for Methylphosphonic Acid 13C 99%; Methyl D3 98% 100 Ug Ml In Methanol since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2024Quote: ... Protein concentration was determined by bicinchoninic acid assay using bovine serum albumin (TaKaRa Bio) as the reference standard ...
-
bioRxiv - Biophysics 2022Quote: ... 100 µL of the above mixtures were loaded on 100 µL of TALON resin (Takara Bio, USA), in 200 µL thin-walled PCR tubes and incubated for 5 min at room temperature ...
-
bioRxiv - Molecular Biology 2021Quote: ... and the protein concentration was measured by a bicinchoninic acid (BCA) assay kit (Takara Bio) using bovine serum albumin as the standard ...
-
bioRxiv - Developmental Biology 2019Quote: ... Rabbit anti-Dsred (1:100; Takara, 632496), Mouse anti-Trio (1:100 ...
-
bioRxiv - Cell Biology 2020Quote: ... Rabbit anti-dsRed (1:100, Clontech, 632496), Rabbit anti-Neuroglian (1:50 ...
-
bioRxiv - Developmental Biology 2020Quote: ... Living Colors anti-DsRed (Clontech #632496, 1:100), anti-RFP (Novus Biologicals #42649) ...
-
bioRxiv - Developmental Biology 2019Quote: ... mCherry (Takara Bio or Novus Biologicals, 1:100). For Snail/Dach double immunostaining ...
-
bioRxiv - Developmental Biology 2021Quote: ... to detect mOrange (rabbit, Clontech 632496, 1:100). The polyclonal NvINSM1 antibody was raised by GenScript in rabbit against amino acids 3 – 170 of NvINSM1 expressed in and purified from E.coli ...
-
bioRxiv - Neuroscience 2021Quote: ... hNSC antibody (SC121, 1:100; Takara: Cat #: Y40410) and vGlut 1 (vesicular glutamate transporter 1 ...
-
bioRxiv - Biochemistry 2020Quote: ... The DHTKD1 open reading frame (amino acids 25-919) was amplified using PrimeSTAR GXL DNA Polymerase (Takara) and primers forward (5’-GGT TTA GAA TTC ATG CAG ACC GAG CGG GGC GTT TA-3’ ...
-
bioRxiv - Microbiology 2020Quote: ... Protein concentrations of cell lysates were measured using a bicinchoninic acid protein assay kit (Takara Bio Inc.). Cell lysate containing the same amount of protein was mixed with 10 volumes of methanol and then centrifuged at 20,000 × g for 30 min to precipitate proteins ...
-
bioRxiv - Microbiology 2021Quote: ... The sequence encoding amino acids 2-1273 were cloned into a shuttle plasmid following InFusion cloning (Clontech). The shuttle plasmid encodes a modified human cytomegalovirus major immediate early promoter (IE CMV ...
-
bioRxiv - Molecular Biology 2020Quote: ... Fractions were precipitated with trichloroacetic acid (TCA) and subjected to Western blot analysis (anti-His antibody, Clontech). Additionally ...
-
bioRxiv - Cell Biology 2020Quote: Murine GFP-CIZ1 (845 amino-acids) and GFP-CIZ1Δ2p6p8 (formerly known as ECIZ1) in pEGFP-C3 (Clontech) were described previously (Coverley et al. ...
-
bioRxiv - Immunology 2022Quote: ... After the optimization of PCR cycle number using SYBER Green I Nucleic Acid gel Stain (Takara Bio), transposed fragments were amplified using NEBNext High Fidelity 2× PCR Master mix and index primers ...
-
bioRxiv - Microbiology 2023Quote: ... and double amino acid mutations were introduced using PrimerSTAR® Max DNA Polymerase (# R046A, Takara Bio Inc.). The primers used for the mutation generation were listed in SI data.
-
bioRxiv - Molecular Biology 2022Quote: ... Tagged proteins were bound to 6 (=3 mL bed volume) or 3 mL (=1.5 mL bed volume) pre-equilibrated Talon SuperFlow Metal Affinity Resin from TaKaRa (LarA wt ...
-
bioRxiv - Molecular Biology 2021Quote: ... Beads are then subjected to three TE-TW washes and loaded into WTA PCR (100 μM Truseq PCR primer: IDT, CTACGACGCTCTTCCGATCT; 100 μM SMART PCR primer: IDT, AAGCAGTGGTATCAACGCAGAGT; Terra PCR mix: Takara Bio, 639284) with cycling conditions 98°C for 2min ...
-
bioRxiv - Neuroscience 2020Quote: ... anti-human nuclei (STEM101; Takara, Y40400, IgG1, 1:100) and anti-human NOGOA (Santa Cruz Biotechnology ...
-
bioRxiv - Neuroscience 2021Quote: ... Rapamycin analogue linker drug (AP21967, Clontech, 100 nM, 3hrs), SAR405 (Millipore Sigma ...
-
bioRxiv - Cell Biology 2021Quote: ... rabbit anti-dsRed dilution 1:100 (IF) (Clontech, 632496); mouse anti-M6PR dilution 1:100 (IF ...
-
bioRxiv - Neuroscience 2022Quote: ... mouse anti-STEM101 antibody (Takara Bio Inc., 1:100) to stain for transplanted human NPCs ...
-
bioRxiv - Microbiology 2021Quote: ... and SmartScribe Reverse Transcriptase (TaKaRa 639538; 100 units/reaction)) were added to each of the samples (28) ...
-
bioRxiv - Neuroscience 2020Quote: ... Rabbit anti-DsRed antibody (Clontech, 632496, 1:100 dilution), Guinea pig anti-Period antibody (Gift from Amita Sehgal ...
-
bioRxiv - Genomics 2019Quote: ... 2.5-mM SMARTer Kit Dithiothreitol (100 mM; Clontech, 634936), 1-mM SMARTer Kit dNTP Mix (10 mM each ...
-
bioRxiv - Neuroscience 2023Quote: ... 0.1% Triton X-100) with 400U RNase inhibitor (Takara Bio Recombinant RNase Inhibitor ...
-
bioRxiv - Microbiology 2022Quote: ... 0.03 μl of RNase Inhibitor (100 U/μl, Takara), 0.26 μl of DPBS (Gibco) ...
-
bioRxiv - Developmental Biology 2023Quote: ... rabbit anti-DsRed 1:100 (Takara Bio Clontech 632496), mouse anti-mCherry 1:100 (Takara Bio Clontech 632543) ...
-
bioRxiv - Developmental Biology 2023Quote: ... mouse anti-mCherry 1:100 (Takara Bio Clontech 632543), mouse anti-GFP 1:250 (Abcam Ab1218) ...
-
bioRxiv - Developmental Biology 2023Quote: ... rabbit anti-DsRed 1:100 (Takara Bio Clontech 632496), mouse anti-mCherry 1:100 (Takara Bio Clontech 632543) ...
-
bioRxiv - Developmental Biology 2023Quote: ... mouse anti-mCherry 1:100 (Takara Bio Clontech 632543), mouse anti-GFP 1:250 (Abcam Ab1218) ...
-
bioRxiv - Neuroscience 2021Quote: ... The plasmid called “CFP-Golgi” (containing amino acids 1–81 of ß-1,4glycosyltransferase) was originally purchased from Clontech.
-
bioRxiv - Cell Biology 2020Quote: ... The 10 amino acid duplication 3’ to GFP or mCherry2 on SHH protein was introduced using Infusion (Clontech) using primers (forward 5’TCCGGCGGCAGATCTGCAGAGAACTCCGTGGCGGCCAAATCCGGCGGCTGTTTCCCGG GA and reverse 5’ tcccgggaaacagccgccggatttggccgccacggagttctctgcagatctgccgccgga) ...
-
bioRxiv - Cell Biology 2020Quote: The N-terminal domain of dTBCE (amino acid 1 to 207) was cloned using the Infusion system (Takara) into pET23B (Clontech ...
-
bioRxiv - Biochemistry 2020Quote: One colony was used to inoculate 10mL of selection media (6.9 g/L Yeast Nitrogen Base without amino acids, 0.62g/L Clontech -Leu/-Trp/-Ura dropout supplement ...
-
bioRxiv - Biochemistry 2020Quote: ... Transformed cells were plated on a selection agar (6.9g/L yeast nitrogen base without amino acids, 0.62g/L Clontech -Leu/-Trp/-Ura dropout supplement ...
-
bioRxiv - Microbiology 2020Quote: ... pH 6.9 with 0.4 mg/ml cysteine and 0.135 mg/ml ferric nitrate) under inducing conditions (by adding either 20 ng/mL or 40 ng/mL anhydrous tetracycline (aTC, Clontech #631310)) ...
-
bioRxiv - Microbiology 2022Quote: ... and 50 ng mL−1 or 25 ng mL−1 anhydrotetracycline (aTc, Clontech) and Aeromonas sp ...
-
bioRxiv - Immunology 2023Quote: ... 1 μg/ml anti-hCD28 and 10 μg/ml RetroNectin (Takara, Cat# T100A). PBMCs were loaded in these wells in human T cell media (X-VIVO media ...
-
bioRxiv - Neuroscience 2020Quote: ... MEM (supplemented with non-essential amino acids) from HiMedia (India) and Tet system approved FBS was obtained from Takara Bio USA ...
-
bioRxiv - Developmental Biology 2019Quote: ... Full-length β-catenin and a C-terminal deletion of tle3b (NM_131780, complete reading frame after amino acid 210) were cloned in pGAD (Clontech). Combinations of plasmids to test two-hybrid interactions were co-transformed in Y2Gold yeast strain (Suppl ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... A plasmid encoding the G protein chimera GqGi3 bearing the core of human Gαq and the last 4 amino acid of Gαi3 was generated by primer mutagenesis and In-Fusion HD Cloning (Clontech) in a pcDNA3.1 vector ...
-
bioRxiv - Immunology 2021Quote: ... and SMARTScribe RT (Takara Bio/Clontech, #639536, 100 U/ul) with the denatured RNA and incubating for 90 min at 42°C then heating to 70°C for 10 min ...
-
bioRxiv - Immunology 2021Quote: ... and SMARTScribe RT (Takara Bio/Clontech, #639536, 100 U/ul) with the denatured RNA and incubating for 90 min at 42°C then heating to 70°C for 10 min ...
-
bioRxiv - Cell Biology 2021Quote: ... Lentivirus was concentrated 100-fold using Lenti-X Concentrator (Clontech) and titrated by RT-qPCR Titration Kit (Clontech ...
-
bioRxiv - Cell Biology 2023Quote: ... and concentrated 100-fold using Lenti-X Concentrator (Takara Bio) following the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2023Quote: ... Virus was concentrated 100 times by Lenti-X Concentrator (Takara) after filtering through a 0.45 syringe filter ...
-
bioRxiv - Cell Biology 2020Quote: ... 20 U/ml DNase (TaKaRa) and 10 mg/ml aprotinin ...
-
bioRxiv - Systems Biology 2019Quote: ... 33 μg/mL retronectin (Clontech) and 2.67 μg/mL of DL1-extracellular domain fused to human IgG1 Fc protein (a gift from I ...
-
bioRxiv - Neuroscience 2023Quote: ... 2 µg/ml doxycycline (Takara) was added on day 0 to induce TetO gene expression ...