Labshake search
Citations for Takara Bio :
51 - 100 of 5220 citations for Human Bcl2 Associated Death Promoter BAD ELISA Kit since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2021Quote: ... DNA was gel purified and inserted into pCDNA 3.1 vectors (CMV promoter) by making use of In-Fusion HD Cloning Kits (Takara Bio). EcoR1 and HindIII digested vector was incubated with overlapping PCR fragments (of various different recombinant DNAs ...
-
bioRxiv - Plant Biology 2022Quote: ... PCR fragments representing either the OsSOG1 promoter+GUS gene or OsSGL promoter+GUS gene were inserted into the AscI/AvrII site using an In-Fusion HD cloning kit (Takara) between attL1 and T35S in pE(L1-L2)hpt ...
-
bioRxiv - Plant Biology 2021Quote: The Pro197Ser-mutated ALS genes and the native form of MvALS1 gene were inserted into the pCAMBIA1390 vector under the cauliflower mosaic virus 35S promoter using the In-Fusion DH Cloning Kit (TaKaRa), as described previously (Iwakami et al. ...
-
bioRxiv - Molecular Biology 2020Quote: ... The amplified DNAs were subcloned into the pCK-FLAG vector (CMV promoter-driven vector) at the BamHI and XhoI sites using In-Fusion HD Cloning Kit (Clontech). For dsRBD-deleted DICER ...
-
bioRxiv - Cell Biology 2021Quote: ... The srpHemo promoter fragment was inserted at the Stu1 restriction site of the PCasper4 plasmid52 using the infusion kit from Clontech and the following infusion primer pair ...
-
bioRxiv - Plant Biology 2023Quote: ... the promoter fragment was amplified and cloned between HindIII and XbaI sites using In-Fusion® HD Cloning Kit (Takara), generating pGWB502-HSP90.7pro ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... and cloned into SacI- and Xho-digested pGL3-Promoter vector using the Infusion®HD Cloning kit (Takara Bio #639650). Elements were cloned upstream of the sv40 promoter within the pGL3-Promoter vector ...
-
bioRxiv - Genetics 2024Quote: ... Esrp1 cDNA was cloned into the pcDNA3.1 backbone containing a CMV promoter and SV40 polyA tailing sequence for expression in mammalian cells using the In-Fusion HD Cloning Kit (Clontech) to generate the pcDNA3.1-esrp1-mCherry plasmid ...
-
bioRxiv - Microbiology 2024Quote: ... p24 titration was performed using an anti-p24 ELISA kit according to the manufacturer’s protocol (Lenti-X™ p24 Rapid Titer Kit #631476 from Takara).
-
bioRxiv - Cancer Biology 2021Quote: ... The TRE3G promoter was amplified from the pTRE3G vector (Clontech) and inserted into SpeI/EcoRI sites of pCDH-EF1-Cre.
-
bioRxiv - Cell Biology 2021Quote: ... pEGFP and mCherry vectors were from Clontech (with CMV promoter) with either C1 or N1 cloning sites to obtain the tag either at the N-terminus or C-terminus of Arc ...
-
bioRxiv - Plant Biology 2021Quote: ... the promoter regions were amplified by PCR (PrimeSTAR max, Takara) and cloned into pGEM/T-EASY containing LUC+ for RSL4 and LRL3 ...
-
bioRxiv - Synthetic Biology 2022Quote: ... The promoter fragments were amplified by ExTaq DNA polymerase (TaKaRa). The YeastFab assembly is performed according to the reaction system below ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... The promoter fragment was ligated into the ApaI-linearized pRS41H-lacZ vector using an In-Fusion kit (Takara Bio USA Inc.). The sequence-checked plasmid was transformed into yeasts using the lithium chloride method (Gietz and Woods 2002).
-
bioRxiv - Cell Biology 2024Quote: ... GS linker human IgG1 FC region from pcDNA3-sACE2v2-Fc (IgG1) and PGK promoter puromycin resistance region cloned into lenti CAG-FLAG-dCas9-VPR using infusion cloning kit (Takara, 638947). After packaging the lentivirus ...
-
bioRxiv - Molecular Biology 2023Quote: ... in which the CMV promoter of pAAV-CMV vector (Takara Bio) was replaced by gfaABC1D ...
-
bioRxiv - Biochemistry 2024Quote: ... encoding EGFP under the control of CMV promoter was from Clontech. pReceiver-EGFP (M02Rx ...
-
bioRxiv - Cell Biology 2023Quote: ... and subcloned into a modified pCaSpeR4 vector containing the αTub84B promoter (Marois et al., 2006) using In-Fusion cloning kit (Takara Bio, Japan). Forward primer sequence was 5’-CTAGAGGATCCCCGGGTACCATGGTGAGCAAGGGCGAG-3’ and reverse primer sequence was 5’-TCGAGGGGGGGCCCGGTACCTTAATTGTAAGTAATACTAGATCCAGGGTATAAAGTT GTTC-3’ ...
-
bioRxiv - Molecular Biology 2022Quote: ... and amplified by PCR using a forward primer containing a T7 promoter sequence (Supplemental Table 10) with the Advantage HF 2 kit (Takara Bio 639124) and the following cycling conditions ...
-
bioRxiv - Microbiology 2020Quote: ... Viral titer was determined by the ELISA p24 antigen assay (Lenti-X p24 Rapid Titer Kit, TaKaRa). Monocytes were infected immediately after purification by adding HIV-1BaL virus to the culture at MOI between 3 and 5 based on the p24 titer ...
-
bioRxiv - Microbiology 2022Quote: ... Viral titer was determined by the ELISA p24 antigen assay (Lenti-X p24 Rapid Titer Kit, TaKaRa). Infections of fully differentiated MDM were performed after adherent growth in the presence of M-CSF for seven days ...
-
bioRxiv - Plant Biology 2020Quote: ... a 4.0 kb fragment containing the ERF019 gene and its native promoter was amplified and inserted into pBI101 with BamHI and SacI by In-Fusion HD Cloning Kit (Takara Bio, Shiga, Japan). For awf2 ...
-
bioRxiv - Plant Biology 2021Quote: Bait constructs for Y1H analysis were produced by inserting promoter regions of SDI genes into the multiple cloning site of pTUY1H using In-Fusion® HD cloning kit (Takara Bio Inc.) and then used to transform yeast strain Y187 ...
-
bioRxiv - Cancer Biology 2024Quote: ... Programed cell death was induced by incubating cells in complete DMEM with 1 mM B/B homodimerizer (Clontech) for 15 min at 37°C ...
-
bioRxiv - Bioengineering 2021Quote: ... The virus titre was calculated using the ELISA-based Lenti-X™ p24 Rapid Titer Kit (Takara Bio) following the manufacturer’s instructions.
-
bioRxiv - Evolutionary Biology 2022Quote: ... The α1-subunit genes were inserted at the PH promoter of vectors already containing the corresponding β1-subunit proteins using In-Fusion® HD Cloning Kit (Takara Bio, USA Inc.) and control sequenced ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... The ATP1A1 genes were inserted at the PPH promoter of vectors already containing the corresponding ATP1B1 genes using In-Fusion® HD Cloning Kit (Takara Bio; Cat#638910) and confirmed by sequencing ...
-
bioRxiv - Cell Biology 2020Quote: ... and subcloned into the pTRE2hyg vector (including a tetracycline-responsible promoter, Takara Bio) with the cDNA encoding GFP-H-Ras (a kind gift from A ...
-
bioRxiv - Microbiology 2020Quote: ... The flgC promoter region and gfp were amplified from pCjSpLe94 and pAcGFP1 (Clontech), respectively ...
-
bioRxiv - Bioengineering 2021Quote: ... The Tet3G transactivator (pLVX-EF1a-TET3G) and cognate TRE3GV promoter (pLVX-TRE3G) (Takara) were cloned into modified pGIPZ and pLVX (Takara ...
-
bioRxiv - Neuroscience 2023Quote: ... was similarly constructed with the leptin receptor promoter controlling expression of mCherry (Clontech) without ChR2 ...
-
bioRxiv - Cancer Biology 2024Quote: ... was cloned in reverse orientation of the EF1a promoter using In-Fusion (Takara) cloning ...
-
bioRxiv - Neuroscience 2024Quote: ... The PCR-amplified promoter fragments were inserted into the XhoI-AgeI site of the pAAV using Ligation high Ver.2 (LGK-201; Toyobo: hGFAP(ABC1D) or In-Fusion HD Cloning Kit (Takara Bio, Shiga, Japan: mMBP promoter).
-
bioRxiv - Immunology 2022Quote: Lytic cell death was determined by measuring LDH release from cell-free supernatants using a colorimetric assay (Promega or Takara) according to the manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2024Quote: ... Supernatant containing viral particles was filtered through a 0.45-μm filter and the lentivirus titer determined by enzyme-linked immunosorbent assay (ELISA) with the Lenti-X p24 Rapid Titer (Single Wash) Kit (Takara). To generate cell lines expressing MDA5 variants ...
-
bioRxiv - Neuroscience 2020Quote: ... the Arl8b coding sequence was cloned in the pBI-CMV3 bidirectional promoter vector (Clontech). The KLC1-TAP plasmid was a gift from Larry S ...
-
bioRxiv - Plant Biology 2024Quote: The promoter sequences of STM-orthologs were isolated by TAIL-PCR (TAKARA, no.6108) from the DNA of the representative Brassicaceae species (Extended Data Table 1) ...
-
bioRxiv - Plant Biology 2023Quote: The PCR amplified promoter sequence of AtPHT1;5 gene was cloned into pAbAi vector (Takara) between the SacI and KpnI RE sites following manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2024Quote: ... under the control of the CaMV35S promoter in the binary vector pBI121 (Clontech, USA), was transferred into Agrobacterium tumefaciens strain GV3101 and used to transform tobacco plants by leaf disc method (Horsch et al. ...
-
bioRxiv - Genomics 2024Quote: ... HA36CB1 cells were recombined with TRE:Luciferase (TRE3G promoter from Clontech, driving expression of Luciferase) and subjected to RMCE selection ...
-
bioRxiv - Cell Biology 2024Quote: ... PGK-GFP was made by swapping the CMV promoter in CMV-EGFP-C1 (Clontech) vector with the hPGK promoter amplified from pLenti.PGK.blast-Renilla_Luciferase (Addgene 74444 ...
-
bioRxiv - Biophysics 2023Quote: ... Proteins were purified via immobilized metal affinity chromatography (IMAC) with TALON metal affinity cobalt resin and its associated buffer set (Takara), following the manufacturer’s instructions ...
-
bioRxiv - Systems Biology 2023Quote: ... before library preparation using the SMARTer Human TCR α/β Profiling Kit (Takara Bio). In brief ...
-
bioRxiv - Microbiology 2024Quote: ... The concentration of the viral stock was determined using p24 ELISA (Lenti-X™ p24 Rapid Titer Kit #631476 from Takara). And the doses used in all experiments were chosen by infecting primary CD4 T cells to reach appropriate levels of infection.
-
bioRxiv - Molecular Biology 2021Quote: ... we performed ELISA against HIV p24 (TaKaRa Clontech #632200) according to manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2021Quote: ... we performed ELISA against HIV p24 (TaKaRa Clontech #632200) according to manufacturer’s instructions ...
-
bioRxiv - Genomics 2024Quote: ... and titer quantified using p24 ELISA antigen assay (Takara). MOI=5 was used to transduce 1x1097 EndoC-βH3 cells in culture media without pen/strep and puromycin.
-
bioRxiv - Biophysics 2022Quote: ... This plasmid expresses the PR isoform-B under a tetracycline controllable promoter (TetOff system, Clontech). To perform the SPT experiments ...
-
bioRxiv - Neuroscience 2021Quote: ... pAAV-TRE3G-T2a-YFP contained the TRE3G promoter from pTRE3G (#631168, Clontech, Mountain View, CA), followed in turn by a modified multiple cloning site (BamHI-MfeI-AgeI-NruI-SpeI) ...
-
bioRxiv - Biophysics 2021Quote: ... Protein constructs were expressed under control of a CMV promoter using pEGFP-C1/N1 (Clontech) (enhanced GFP ...