Labshake search
Citations for Takara Bio :
51 - 100 of 833 citations for Fatty acid binding protein FABP3 Human His since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: ... His (Takara/Clontech 631212, 1:1000), GFP (Roche 11814460001 ...
-
bioRxiv - Neuroscience 2022Quote: ... Constructs for human Tara were prepared by cloning full-length TRIOBP1 (Trio and F-actin binding protein1) isoform into pEGFP-C3 (Clontech, Mountain View, CA, USA), pFLAG-CMV2 (Sigma-Aldrich) ...
-
bioRxiv - Molecular Biology 2021Quote: ... and the protein concentration was measured by a bicinchoninic acid (BCA) assay kit (Takara Bio) using bovine serum albumin as the standard ...
-
bioRxiv - Molecular Biology 2022Quote: ... genes were cloned into a His-SUMO fusion protein expression vector (Kim et al, 2018) using an In-Fusion Cloning Kit (639648, Takara Bio). The glycine-arginine-proline (GRP ...
-
bioRxiv - Biochemistry 2024Quote: ... Recombinant His-tagged protein was purified from cell-free extracts using immobilized metal affinity chromatography (IMAC using Talon resin; Takara Bio). The buffer used during the purification process was 20 mM Tris-HCl ...
-
bioRxiv - Bioengineering 2019Quote: ... SD-His or SD-Trp-Ura (Clontech). Mycoplasma pneumoniae strain M129 (ATCC 29342) ...
-
bioRxiv - Plant Biology 2021Quote: ... Recombinant proteins were induced by 1 mM IPTG at 16°C for 20 h, then purified by a GST-tag Protein Purification Kit (Beyotime, Shanghai, China) or His TALON Purification Kit (Takara, Beijing, China). Corresponding primers are listed in Supplemental Table S2.
-
bioRxiv - Plant Biology 2023Quote: ... and a rabbit LexA binding domain antibody (Clontech), respectively.
-
bioRxiv - Neuroscience 2022Quote: 50 µg of human cerebral cortex lysate (Protein Medley, Takara, Kusatsu, Japan, Cat. No. 635323) were diluted and prepared according to manufacturer’s instructions (protocol PT1602-1) ...
-
bioRxiv - Plant Biology 2022Quote: ... and impact of SAID1/SAID2 on SE interaction with other proteins was examined on SD-His/-Leu/-Met/-Trp quadruple dropout medium (Clontech, Cat. No. 630429) supplemented with 5 mM 3-amino-1,2,4-triazole (3-AT ...
-
bioRxiv - Microbiology 2019Quote: ... and loaded on His 60 Ni resin (TAKARA) after equilibrating ...
-
bioRxiv - Microbiology 2022Quote: ... Western blots using Anti-His primary antibody (Clontech) (1:4000 dilution ...
-
bioRxiv - Plant Biology 2021Quote: ... whereas selective media additionally lacked His (−4) (Clontech).
-
bioRxiv - Molecular Biology 2019Quote: ... Clarified lysates were incubated with HIS-60 (Takara) resin for 30-60 minutes ...
-
bioRxiv - Plant Biology 2020Quote: ... 3-μL aliquots of each dilution were used to inoculate SD/−Trp/−His/−Ade medium and SD/−Trp/−His medium with X-α-Gal (Clontech). The inoculated media were incubated for 4 days at 30 °C ...
-
bioRxiv - Microbiology 2021Quote: ... His-Raf1, His-ATG8) and empty plasmids (GST tag, 6×His tag) were transformed into component cells Escherichia coli BL21 (Takara, 9126) or BL21 (DE3 ...
-
bioRxiv - Immunology 2023Quote: ... The 6-His tagged recombinant proteins were purified from the supernatant by gravity-fed through TALON® Metal Affinity Resin (Takara Bio, Shiga, Japan). Following a wash step with PBS (pH 8) ...
-
bioRxiv - Cell Biology 2020Quote: ... The 10 amino acid duplication 3’ to GFP or mCherry2 on SHH protein was introduced using Infusion (Clontech) using primers (forward 5’TCCGGCGGCAGATCTGCAGAGAACTCCGTGGCGGCCAAATCCGGCGGCTGTTTCCCGG GA and reverse 5’ tcccgggaaacagccgccggatttggccgccacggagttctctgcagatctgccgccgga) ...
-
bioRxiv - Plant Biology 2022Quote: ... His (SD/-Trp/-Leu/-Ade/-His) and with sprayed 100 µl of 4 mg/ml X-α-Gal (Takara Bio, CA, USA) in dimethylformamide on plates (SD/-Trp/-Leu/-His/X-α-Gal) ...
-
bioRxiv - Plant Biology 2020Quote: ... Ade and His but containing X-α-gal (Clontech) and 10 mM 3-amino-1,2,4-triazole (3-AT) ...
-
bioRxiv - Biochemistry 2019Quote: ... a 96-well Capturem His-tagged purification kit (Clontech) was used according to the manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2020Quote: ... and –His/–Trp/–Ura dropout supplement (Clontech, cat. 630424). Colonies were grown in SD/–His/–Trp/–Ura medium for one night at 30 °C ...
-
bioRxiv - Synthetic Biology 2023Quote: ... SD-Trp-Ura or SD-His-Leu (Clontech Takara).
-
bioRxiv - Synthetic Biology 2023Quote: ... SD-Trp-Ura or SD-His-Leu (Clontech Takara).
-
bioRxiv - Immunology 2020Quote: ... For binding studies the 6xHis tag were removed from some Fabs by treatment with PreScission protease (MolBioTech; ThermoScientific) and the protein repurified on cobalt-nitrilotriacetic acid (Co-NTA) agarose (Clontech) followed by gel filtration chromatography on Superdex 200 (GE Healthcare ...
-
bioRxiv - Neuroscience 2023Quote: ... SMARTer Stranded Total Sample prep kit-HI Mammalian (Takara, 634875) was used to generate libraries for RNA sequencing.
-
bioRxiv - Molecular Biology 2022Quote: ... downstream of the His tag with In-Fusion HD (TaKaRa). The Gly172Phe substitution was induced by site-directed mutagenesis.
-
bioRxiv - Molecular Biology 2022Quote: ... downstream of the His tag with In-Fusion HD (TaKaRa). The His154Gly substitution was induced by site-directed mutagenesis.
-
bioRxiv - Biochemistry 2023Quote: ... Cleavage of the His-tag by HRV3C protease (Takara, 7360) followed the manufacturer’s protocol ...
-
bioRxiv - Immunology 2024Quote: ... His-tagged CD45RO was purified by TALON affinity resin (Takara) according to the manufacturer’s instructions ...
-
bioRxiv - Genetics 2022Quote: ... then washed in water and re-suspended in 125-250mL -leu - his galactose liquid culture (Takara Bio Minimal SD Bases, Takara Bio DO Supplement -His/-Leu). Cultures were grown to saturation ...
-
bioRxiv - Biophysics 2020Quote: ... The complex was then purified by binding on Talon resin (Clontech) and eluted in 150 mM imidazole ...
-
bioRxiv - Biochemistry 2019Quote: ... Western blotting was performed with anti-6×His mouse mAb (Clontech), with secondary IRDye 800CW goat anti-mouse (LI-COR ...
-
bioRxiv - Neuroscience 2021Quote: ... His-tagged Cbln1 were purified by Talon metal affinity resin (Clontech) and dialyzed against HBSS ...
-
bioRxiv - Molecular Biology 2020Quote: ... The supernatant was incubated with TALON His-tag purification resin (TaKaRa) or glutathione agarose beads (Sigma-Aldrich ...
-
bioRxiv - Plant Biology 2023Quote: ... and purified with Capturem™ His-Tagged Purification Maxiprep Kit (Takara). The binding reaction was performed in 20 μL binding buffer (10 mM Tris pH 8.0 ...
-
bioRxiv - Microbiology 2023Quote: A yeast screen for human cellular interacting proteins of pUL136 was performed using the Matchmaker Gold Yeast Two-Hybrid System (Clontech) and the Mate and Plate Universal Human Library (Clontech) ...
-
bioRxiv - Immunology 2022Quote: ... Supernatants were purified using Capturem™ His-Tagged Purification kit (Takara Bio), then dialyzed by PBS buffer overnight ...
-
bioRxiv - Microbiology 2019Quote: ... The resulting fragment was cell-free cloned into pNI-His (Takara Bio) for expression in B ...
-
bioRxiv - Microbiology 2021Quote: abTse3-His was cloned into vector pET28a by In-Fusion (Takara Bio). E ...
-
bioRxiv - Microbiology 2020Quote: ... and spotted on SD supplemented with -Leu/-Trp/-His DO supplement (Clontech) (SD-Leu-Trp-His ...
-
bioRxiv - Molecular Biology 2021Quote: ... transferred onto nitrocellulose and detected with either mouse anti-6×His (Clontech) at 0.25 µg/ml or rabbit antibody against calmodulin binding peptide Calmodulin Binding Peptide (GenScript ...
-
bioRxiv - Microbiology 2023Quote: ... embedding and immunogold staining using a 6×His monoclonal antibody (Takara Bio) diluted 1/5000 as the primary antibody ...
-
bioRxiv - Plant Biology 2020Quote: ... βC1 was fused with binding domain and cloned into pGBKT7 BD (Takara Bio). Plasmids were transformed into AH109 strain as described previously (Gietz and Woods ...
-
bioRxiv - Plant Biology 2021Quote: ... Culture mediums SD/-Leu/-Trp and SD/-Ade/-His/-Leu/-Trp (Clontech, USA) with or without X-α-gal were used to select the positive transformants.
-
Plant pathogens convergently evolved to counteract redundant nodes of an NLR immune receptor networkbioRxiv - Plant Biology 2021Quote: ... and on a SD-Leu-Trp-Ade-His plate (ST0054, Takara Bio, USA) containing X-α-gal and supplemented with 0.2% Adenine ...
-
bioRxiv - Systems Biology 2021Quote: ... selecting on SD -HIS agar plates (Takara Bio, 630411; Diagonal GmbH&CoKG, Y1751). The correct genomic context insertion of GFP of single colonies was confirmed by PCR using a combination of primers which also allowed the confirmation of the intron deletion strain ...
-
bioRxiv - Microbiology 2023Quote: ... templates with primers encoding a His-tag and NcoI/NotI cut sites (Takara), cloned into pET22b ...
-
bioRxiv - Cell Biology 2023Quote: Hexa-Histidine (6×His)-tagged bacterial expression constructs were created using pColdI (Takara) vector backbone ...
-
bioRxiv - Plant Biology 2021Quote: ... SD growth medium w/o Ade−His−Leu−Trp− (Himedia) and supplements media (Clontech) were used for the Y2H experiment.