Labshake search
Citations for Takara Bio :
901 - 950 of 1449 citations for 1 1 Dimethylsila 11 Crown 4 since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2022Quote: cDNA was synthesized with 1 μg of total RNA using the Prime ScriptTM RT Reagent Kit (Takara) according to manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2024Quote: ... the plug was incubated in 160 μL of 1× M buffer containing 160 units of NheI (TaKaRa) overnight at 37°C ...
-
bioRxiv - Developmental Biology 2024Quote: ... 1 ul of the cDNA was used for PCR reaction using CloneAmp HiFi PCR Premix (Takara, 639298) with the following primers ...
-
bioRxiv - Cell Biology 2024Quote: ... The following antibodies were used: anti-GFP (JL-8; 1:20, Clontech, Saint-Germain-en-Laye, France), anti-PHB1 (EP2803Y ...
-
bioRxiv - Cell Biology 2024Quote: ... Actin and GAPDH (primers in Table 1) in ovaries by using TB Green syber mix (Takara - RR820A) as per manufacturer instructions ...
-
bioRxiv - Biochemistry 2022Quote: ... pDONR/Zeo (Supplementary Table 1) plasmid with the desired mutation was done via In-Fusion technology (Takara). Each pDONR/Zeo Cac1 mutant plasmid was verified by Sanger sequencing ...
-
bioRxiv - Cell Biology 2022Quote: ... 1 μg of total RNA was reversely transcribed into cDNA using the PimeScript RT-PCR kit (TAKARA) and analyzed by qPCR on LightCycler96 system (Roche ...
-
bioRxiv - Neuroscience 2023Quote: ... 1 ng total RNA was used for SMART-Seq HT PLUS (Takara Bio USA, Inc. Cat # R400748) following manufacturer’s protocol ...
-
bioRxiv - Immunology 2023Quote: Primary antibodies used for imaging include Living Colors anti-DsRed Rabbit Polyclonal Pan Antibody (1:500; TaKaRa), Chicken Polyclonal anti-GFP (1:300 ...
-
bioRxiv - Molecular Biology 2023Quote: ... Total RNA (1 μg) was reverse transcribed with the PrimeScript™RT Reagent Kit (Takara Bio Inc.) according to the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2023Quote: ... Sections were then incubated with primary goat anti-dsRED (1:1000, Takara Bio, Cat# 632496, RRID: AB_10013483), goat anti-ChAT (1:400 ...
-
bioRxiv - Biochemistry 2023Quote: ... and a fusion construct containing nucleotides of CPY (1-50) and Atg15ΔN35 was generated by ligation (Clontech). To generate pRS426-ATG15-3xFLAG (TPL003) ...
-
bioRxiv - Cell Biology 2023Quote: ... The following antibodies were used for the study: mouse anti-GFP (632381, JL-8, Clontech, 1:1000), rabbit anti-mCherry (GTX128508 ...
-
bioRxiv - Neuroscience 2024Quote: ... and anti-RFP antibodies (1/1000, RT, overnight, rabbit anti-DsRed, 632496, Takara Bio USA, Madison, WI), followed by Alexa-488 (1/100 ...
-
bioRxiv - Cancer Biology 2024Quote: ... and cDNA was synthesized from 1 μg RNA using PrimeScriptTM RT Master Mix kit (Takara, Cat#RR036A) following the manufacturer’s protocols ...
-
bioRxiv - Bioengineering 2024Quote: ... Transfer clarified supernatant to fresh container and combine 1 volume of Lenti-X concentrator (TaKaRa; Cat.no: 631232) to 3 volumes of clarified supernatant ...
-
bioRxiv - Plant Biology 2024Quote: ... Total RNA (1 μg) was reverse transcribed into cDNA using PrimeScript RT reagent kit (Takara Bio, Japan), and expression was quantified using the TB Green® Premix Ex Taq™ II (Takara) ...
-
bioRxiv - Synthetic Biology 2024Quote: ... The resin was washed twice by incubating it with 1 mL equilibration buffer for 10 minutes (Takara), centrifuging the resin (700xg for 5 minutes ...
-
bioRxiv - Genetics 2024Quote: ... 1–1249 (full-length) were cloned into an EGFPC1 plasmid (N-terminal GFP tag) (Takara Bio, CA). For non-cleavable INF2 ...
-
bioRxiv - Molecular Biology 2024Quote: ... cDNA was synthesized from 1 μg of extracted RNA per sample using the SMARTScribe reverse transcriptase (Clontech) and dT primer (GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG T30VN) ...
-
bioRxiv - Neuroscience 2024Quote: ... we performed immuno-staining using primary antibody rabbit anti-dsRed (Takara Bio, Cat. No. 632496, 1:300) and secondary antibody goat anti-rabbit ...
-
bioRxiv - Neuroscience 2024Quote: ... 1 ng of RNA was reverse-transcribed using the SMART-Seq v4 Low Input RNA kit (Takara). cDNA were quantified and qualified using Qubit (Invitrogen ...
-
bioRxiv - Biophysics 2024Quote: ... The supernatant was incubated overnight with 1 mL of Talon (immobilized metal affinity chromatography, IMAC) resin (Takara) in the presence of 10 mM imidazole ...
-
bioRxiv - Cancer Biology 2024Quote: ... RT-PCR was performed using diluted cDNA (1:5 in water) and PrimeStar DNA Polymerase (Takara, R010A) with primers and PCR conditions listed in Table 1 ...
-
bioRxiv - Synthetic Biology 2024Quote: ... and 1 μg RNA was reverse-transcribed into cDNA using the PrimeScript RT Reagent Kit (RR037B, Takara). RT-qPCR analysis was conducted using Hieff SYBR Green Master Mix Kit (11201ES08 ...
-
bioRxiv - Cell Biology 2024Quote: ... 250 μL of DNA after sonication were incubated with 1 μL of DNA carrier (ST0029, TakaRa Bio), 25 μL of BSA 5% (BP1600 ...
-
bioRxiv - Developmental Biology 2024Quote: ... mRNA was isolated from 1 µg total RNA by polyA selection (PrepX polyA 48, Takara Bio 640098) and checked for rRNA contamination using the mRNA 2100 Bioanalyzer chip and protocol (Agilent) ...
-
bioRxiv - Genetics 2024Quote: ... Viral supernatant was harvested after 48 hours and concentrated 1:10 using the Lenti-X concentrator (Takara). Concentrated supernatant was resuspended in PBS and stored at -80°C ...
-
bioRxiv - Plant Biology 2020Quote: ... After 4 h total RNA was extracted using RNAiso Plus (Takara Bio, Shiga, Japan) according to the manufacturer’s protocol and used for real-time quantitative RT-PCR (qRT-PCR ...
-
bioRxiv - Biochemistry 2020Quote: ... The supernatant was applied to 4-mL Talon Metal Affinity Resin (Clontech, cat# 635503). After washing with 30 mL wash buffer containing 20 mM HEPES at pH 7.5 ...
-
bioRxiv - Molecular Biology 2022Quote: ... the larvae were fixed in 4% PFA for imaging or RNAiso Plus (Takara, 9109) for RNA isolation.
-
bioRxiv - Biophysics 2021Quote: ... The resultant supernatant was mixed with 4 mg of Talon Metal Affinity Resin (Takara) equilibrated with wash buffer [50 mM Na-Pi pH 8.0 ...
-
bioRxiv - Plant Biology 2022Quote: ... StNPR1 and StNPR3/4 were inserted also into the pGADT7 (prey) vector (Clontech, USA), to produce proteins with an N-terminal Gal4 activation domain ...
-
bioRxiv - Genomics 2024Quote: Approximately 4×106 HAP1 cells were transfected using Xfect Transfection Reagent (#631318, Takara Bio) for each pSpCas9(BB)-2A-Puro construct ...
-
bioRxiv - Pathology 2023Quote: ... Affinity purification was performed at 4°C using Talon metal affinity resins (Clontech, TaKaRa Biomedical Technology [Beijing] Co. ...
-
bioRxiv - Bioengineering 2024Quote: ... Cas9-EDVs were produced by seeding approximately 4 million Lenti-X cells (Takara Bio) into 10 cm tissue culture dishes (Corning ...
-
bioRxiv - Cancer Biology 2021Quote: Full-length cDNA was synthesized from total RNA (1 μg) by SMARTer®□ PCR cDNA Synthesis kit (Clontech) according to the manufacture’s instruction ...
-
bioRxiv - Cancer Biology 2021Quote: ... cDNA was obtained from 1 µg of total RNA from each sample (Super M-MLV reverse transcriptase, TAKARA) and QPCR was performed using TaqMan™ Gene Expression Master Mix (4369016 ...
-
bioRxiv - Cell Biology 2020Quote: ... 1 μg of total RNA was reverse transcribed using Takara PrimeScript™ RT Master Mix (Clontech Laboratories, USA). qRT-PCR was performed on Step One Plus Real-Time PCR System (Applied Biosystems ...
-
bioRxiv - Neuroscience 2021Quote: ... Sections were then stained using primary antibodies against the reporter proteins mCherry (Clontech 632543 RRID: AB_2307319, 1:250) and against the panneuronal marker NeuN (millipore MAB377 RRID ...
-
Evolutionary conserved aspects of animal nutrient uptake and transport in sea anemone vitellogenesisbioRxiv - Evolutionary Biology 2022Quote: ... They were then incubated with primary antibody (rabbit anti-DsRed, 1:100, Takara Bio Clontech, order nr. 632496) overnight at 4°C ...
-
Evolutionary conserved aspects of animal nutrient uptake and transport in sea anemone vitellogenesisbioRxiv - Evolutionary Biology 2022Quote: ... They were then incubated with primary antibody (rabbit anti-DsRed, 1:100, Takara Bio Clontech, order nr. 632496) overnight at 4°C ...
-
bioRxiv - Neuroscience 2021Quote: ... The plasmid called “CFP-Golgi” (containing amino acids 1–81 of ß-1,4glycosyltransferase) was originally purchased from Clontech.
-
bioRxiv - Systems Biology 2021Quote: ... Other plasmid components (see Supplementary Table 1) were synthesized or PCR amplified with PrimerSTAR MAX DNA polymerase (TAKARA) and checked by Sanger sequencing ...
-
bioRxiv - Synthetic Biology 2021Quote: ... The cDNA was synthesized from 1 μg of total RNA using the PrimeScript™ RT-PCR Kit (Takara). Three technical replicates were measured for gene expression levels in each cDNA sample ...
-
bioRxiv - Molecular Biology 2021Quote: ... 1 μg each CAS9 guide RNA plasmid (pAS4883 and 4884) and 200 ng linear hygromycin resistance gene (Clontech) were used ...
-
bioRxiv - Neuroscience 2020Quote: ... we combined 494 μL of internal solution with 6 μL of recombinant RNase inhibitor (1 U/μL, Takara) in order to increase RNA yield ...
-
bioRxiv - Microbiology 2021Quote: ... pAS1b-HA-TAROR (1-931) or pAS1b-HA-TASOR (630-1512) have been constructed by InFusion technology (Takara) according to the kit manufacture guide ...
-
bioRxiv - Cell Biology 2021Quote: ... First-strand cDNA was synthesized by reverse transcription of 1 μg RNA using PrimeScrip RT Master Mix(Takara). Quantitative real time-PCR was performed using TB Green Premix Ex Taq (Takara ...
-
bioRxiv - Cell Biology 2021Quote: ... Reverse transcription reactions containing 1 μg of total RNA were performed using PrimeScript™ (Takara, Otsu, Shiga, Japan). Individual cDNAs were amplified with THUNDERBIRD™ SYBR qPCR Mix (TOYOBO CO ...