Labshake search
Citations for Takara Bio :
751 - 800 of 1449 citations for 1 1 Dimethylsila 11 Crown 4 since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2024Quote: ... Primary antibodies used in this study include Rabbit-anti-DsRed (Clontech #632496, 1:1000), Goat anti-GFP (Sicgen ...
-
bioRxiv - Molecular Biology 2024Quote: ... The lysis buffer was prepared by mixing 1 µL RNase inhibitor (TaKaRa, Cat# 2313A) and 19 µL 10X lysis buffer (TaKaRa ...
-
bioRxiv - Plant Biology 2024Quote: ... 1 ml of 100 mM Isopropyl β-D-thioglactopyranoside (IPTG, Takara Bio Inc., Japan) was added to the culture medium ...
-
bioRxiv - Bioengineering 2024Quote: ... supernatants were harvested and mixed 1 to 3 with Lenti-X concentrator (Takara, 631232), cooled down to 4C for 30 minutes and spun down for 45 minutes at 4C.
-
bioRxiv - Biophysics 2024Quote: ... B0202S) with the presence of 1/250 volume of T4 ligase (Takara Bio, 2011A) at the concentration of 1.05-4.2 pg/µL at 37 °C for 20 min ...
-
bioRxiv - Biophysics 2024Quote: ... The supernatant was then added to 1 mL of Talon cobalt resin (Takara 635652) and incubated with rotation for 1 hr at 4 C° ...
-
bioRxiv - Microbiology 2022Quote: ... expression was induced by addition of 4 ng/ml anhydrotetracycline (Clontech) at 4 hpi.
-
bioRxiv - Microbiology 2021Quote: ... 4 μl of 5X In-Fusion premix (Takara Bio, cat#638909), and milliQ water up to 20 μl ...
-
bioRxiv - Microbiology 2024Quote: ... Transfection was performed using 4 µL TransIT 293 (Takara, Shiga, Japan) and 100 µL OPTI-MEM (Thermo Fisher Scientific) ...
-
bioRxiv - Bioengineering 2024Quote: ... cerevisiae SH-4 cells using NucleoSpin RNA (Takara Bio, Otsu, Japan) and Quick-RNA MiniPrep Plus (Zymo Research The MGIEasy RNA Directional Library Prep Set (MGI Tech ...
-
bioRxiv - Developmental Biology 2021Quote: ... cDNA was synthesized from 1 μg total RNA using a PrimeScript RT reagent kit (Takara) according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2020Quote: ... cDNA (1:10 diluted) was mixed with target-specific primers and SYBR Green Supermix (Takara). Data analysis was done using Viia7 sequence detection interface (Applied Biosystems) ...
-
bioRxiv - Developmental Biology 2021Quote: ... beads were resuspended with 27 µl ddH2O and 1 µl 10× Ex-Taq buffer (TaKaRa). 1 µl proteinase K (Roche ...
-
bioRxiv - Molecular Biology 2021Quote: The following antibodies were used for western blotting: mouse anti-GFP (1:5000; Clontech 632381), rabbit anti-Vinculin (1:1000 ...
-
bioRxiv - Microbiology 2020Quote: ... Primary antibody used for western blotting (WB) was anti-GFP (Clontech #632592, dilution 1:1000). Secondary conjugated antibodies used for western blotting were Beta Actin HRP conjugated antibody (Abcam ...
-
bioRxiv - Neuroscience 2020Quote: ... Cells were resuspended in 500uL FACS buffer with RNase inhibitor (Takara Bio 2313B, 1:500) and 0.5ul Propidium Iodide (ThermoFisher Scientific P3566 ...
-
bioRxiv - Neuroscience 2021Quote: ... Total RNA (1 µg) was reverse-transcribed with PrimerScript™ RT Master Mix (Takara, #RR047A) after DNase I treatment (Takara ...
-
bioRxiv - Molecular Biology 2020Quote: ... After incubation with horseradish peroxidase-conjugated secondary antibody (IgG detector, Takara Clontech, Cat# T7122A-1), the antigen was detected using chemiluminescence Western blotting detection reagents (Pierce ECL Western Blotting Substrate ...
-
bioRxiv - Molecular Biology 2020Quote: ... After incubation with horseradish peroxidase-conjugated secondary antibody (IgG detector, Takara Clontech, Cat# T7122A-1), the antigen was detected using chemiluminescence Western blotting detection reagents (Pierce ECL Western Blotting Substrate ...
-
bioRxiv - Molecular Biology 2020Quote: ... After incubation with horseradish peroxidase-conjugated secondary antibody (IgG detector, Takara Clontech, Cat# T7122A-1), the antigen was detected using chemiluminescence Western blotting detection reagents (Pierce ECL Western Blotting Substrate ...
-
bioRxiv - Neuroscience 2021Quote: ... The coding region of rGAT-1 was inserted into pEYFP-C1 (Clontech, Palo Alto, CA). QuikChange Site-directed Mutagenesis kit was utilized to introduce the GAT-1 variants into a wildtype GAT-1 plasmid ...
-
bioRxiv - Cell Biology 2021Quote: ... the annealed oligo duplex at a 1:3 mol ratio and ligation mix (Takara Bio) at 16 °C for 30 min ...
-
bioRxiv - Biophysics 2020Quote: ... and allowed to bind to cobalt resin (Talon, Clontech; 1 mL bed volume/L culture). The column was washed sequentially with cobalt wash buffer (CoWB ...
-
bioRxiv - Biophysics 2022Quote: HIV-1 Gag (75) was ligated into pEGFP-N1 (Clontech, Takara Bio, Mountain View, CA) to generate the HIV-1 Gag-EGFP vector ...
-
bioRxiv - Biophysics 2022Quote: HIV-1 Gag (75) was ligated into pEGFP-N1 (Clontech, Takara Bio, Mountain View, CA) to generate the HIV-1 Gag-EGFP vector ...
-
bioRxiv - Cancer Biology 2021Quote: ... using the primers listed in Table 1 with the In-Fusion HD cloning system (Takara). To silence GSK3B expression ...
-
bioRxiv - Biochemistry 2020Quote: ... tricornutum genomic DNA using primers described in Table 1 (Supplemental Information) and Primestar polymerase (Takara) with primers LYS13-LYS16 ...
-
bioRxiv - Biochemistry 2020Quote: ... and the supernatant was mixed with 1 mL of TALON® metal affinity beads (Clontech) previously equilibrated with equilibration buffer (PBS pH 8 ...
-
bioRxiv - Cancer Biology 2022Quote: ... Total RNA (1 μg) was reverse transcribed by a reverse transcription kit (RR047A, Takara, China). Real-time quantitative PCR was performed on ABI 7500 system (Applied Biosystems ...
-
bioRxiv - Molecular Biology 2020Quote: ... After incubation with horseradish peroxidase-conjugated secondary antibody (IgG detector, Takara Clontech, Cat# T7122A-1), the antigen was detected using chemiluminescence Western blotting detection reagents (Pierce ECL Western Blotting Substrate ...
-
bioRxiv - Microbiology 2020Quote: The HSV-1 copy number was examined by qPCR using SYBR/ROX (RR82LR; Takara, Japan) on ABI qPCR machine (Lifetech ...
-
bioRxiv - Microbiology 2021Quote: ... protein expression was induced with 1 mM of isopropyl-β-D-thiogalactopyranoside (IPTG; Takara Bio) at the final concentration at 25°C ...
-
bioRxiv - Biochemistry 2021Quote: ... Permeabilized cells were then mock treated or treated with 1 mg/ml RNase A (Takara) diluted in PBS for 20 minutes at room temperature ...
-
bioRxiv - Neuroscience 2020Quote: ... rDA1m was immunostained using a rabbit anti-RFP antibody (1:1000, Takara, cat. number 632496) followed by a Cy3-conjugated donkey anti-rabbit secondary antibody (1:1000 ...
-
bioRxiv - Genomics 2020Quote: ... in a 1:8 vector:insert optimized ratio and transformed into Stellar competent cells (636766, Clontech) to maximise the number of individual transformants (800,000 individual clones) ...
-
bioRxiv - Molecular Biology 2020Quote: ... the final volume was increased to 1 mL using SOC medium (cat. no. ST0215, Takara) pre-warmed to 37 °C ...
-
bioRxiv - Molecular Biology 2020Quote: ... 150 mM NaCl and 1 mM DTT]23 or CellAmp Processing Buffer (TaKaRa, Kusatsu, Japan) or Lysis Solution of SuperPrep (TOYOBO ...
-
bioRxiv - Neuroscience 2020Quote: ... and 1 μg was reverse-transcribed using PrimeScriptTM RT Reagent Kit (perfect Real Time) (Takara). RT-qPCR was performed with qPCRBIO SyGreen Mix LoRox polymerase (Cultek ...
-
Dynamic states of eIF6 and SDS variants modulate interactions with uL14 of the 60S ribosomal subunitbioRxiv - Biochemistry 2022Quote: ... pRSF-DUET-1-EIF6 construct was used to express eIF6 and the pTf16 (Takara Biosciences) construct was used to express the TF chaperone ...
-
bioRxiv - Plant Biology 2022Quote: ... The PCR products and pGEX6P-1 vector were digested with EcoRI (Takara Bio, Shiga, Japan) and NotI (Takara Bio ...
-
bioRxiv - Plant Biology 2022Quote: ... eGFP was immuno detected with anti-GFP antibody (1:4000 dilution) (JL-8, #632380, Takara) and anti- mouse-HRP (1:15000 dilution ...
-
bioRxiv - Plant Biology 2022Quote: ... was amplified using following primer pairs (AtEH1_1-527_GBD_F GCCATGGAGGCCGAATTCCCAATGGCGGGTCAGAATCCTAACATGG and AtEH1_1-527_GBD_R CTGCAGGTCGACGGATCCCCTTATGCAGAATATCCATT ACCTAGGTGATTAGC) and cloned into the pGBKT7 vector (Clontech). The cytoplasmic part of CLV1 (AA 671 to 980 ...
-
bioRxiv - Neuroscience 2024Quote: ... and resuspended in PBS with 0.3%BSA and 1% recombinant RNase inhibitor (RRI, Takara Bio). Next ...
-
bioRxiv - Developmental Biology 2024Quote: ... cDNA libraries were then synthesized using the SMARTer PCR cDNA Synthesis Kit (Clontech; PT4097-1) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2024Quote: 1 x 106 ACKP cells were transfected with 3 µg pE2F-TA-luc plasmid (Takara) and 0.3 µg renilla luciferase control plasmid pRL-CMV (Promega ...
-
bioRxiv - Cell Biology 2022Quote: ... the cells were treated with 200 ng ml−1 of Dox (#631311; TaKaRa, Kusatsu, Japan) for 24 h ...
-
bioRxiv - Cell Biology 2023Quote: ... cells were pre-treated 1 hour prior to the assay with A/C Heterodimerizer (Takara) diluted at 1:200 in complete media concurrent with JF-Halo or -SNAP dye labeling ...
-
Retrovirus-derived RTL9 plays an important role in innate antifungal immunity in the eutherian brainbioRxiv - Evolutionary Biology 2023Quote: ... 10 ng cDNA in a 25 μl reaction mixture containing 1 X ExTaq buffer (TaKaRa), 200 μM each of NTP and 800 nM of primers along with 0.625 units ExTaq HS (TaKaRa ...
-
bioRxiv - Neuroscience 2023Quote: ... followed by blocking solution containing primary antibodies against mCherry (mouse monoclonal 1:500, Takara Bio) and c-Fos (rabbit polyclonal 1:500 ...
-
bioRxiv - Developmental Biology 2023Quote: ... 1 µg of total RNA was converted to cDNA using M-MLV reverse transcriptase (TAKARA) under standard conditions with oligo(dT ...