Labshake search
Citations for Takara Bio :
851 - 900 of 922 citations for Kallikrein 3 PSA Human HEK293 His since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... The resulting PCR product was cloned between the 3’ and 5’ arms of the Rosa26 targeting vector using In-Fusion cloning (Takara Bio). Plasmid sequence was checked by sequencing ...
-
bioRxiv - Cancer Biology 2023Quote: ... Three RNA lysis aliquots of the LC6 sample were processed and library preparation completed on the 3 aliquots with SMART-Seq® HT Kit (Takara) and Illumina Nextera reagents for tagmentation ...
-
bioRxiv - Evolutionary Biology 2023Quote: Complete cDNA sequences of taste receptors were obtained using a SMARTer 5’/3’ kit for RACE PCR to obtain 5’ sequence information missing from reference transcriptome (Takara, #634858). Briefly ...
-
bioRxiv - Cancer Biology 2023Quote: ... and clonally isolated p53 KO cell lines were electroporated with 3 µg p53 firefly luciferase reporter plasmid pp53-TA-Luc (Clontech/Takara) and 0.3 ug renilla luciferase control plasmid pRL-CMV (Promega ...
-
bioRxiv - Molecular Biology 2024Quote: ... the U2OS 2-6-3 cells expressing degron-tagged LacI fusion proteins were incubated with 300 nM Shield1 ligand (Takara Bio) and 1 µg/mL doxycycline for 24 hours ...
-
bioRxiv - Microbiology 2023Quote: ... reverse transcription of the RNA using a primer designed to the constant region of the barcoded adaptor with addition of an adapter to the 3’ end of the cDNA by template switching using SMARTScribe Reverse Transcriptase (Takara ClonTech #639538) as described92 ...
-
bioRxiv - Biophysics 2023Quote: ... 5’-CTGGAGAATCCCGGTGC-3’ and 5’- GTGTCAGATATATACATCCTGT-3’ and the PCR product was purified using a NucleoSpin Gel and PCR Clean-up Maxi kit (Takara Bio). The sequences of the 147 bp and 177 bp DNA are as follows:
-
bioRxiv - Neuroscience 2022Quote: ... Constructs for human Tara were prepared by cloning full-length TRIOBP1 (Trio and F-actin binding protein1) isoform into pEGFP-C3 (Clontech, Mountain View, CA, USA), pFLAG-CMV2 (Sigma-Aldrich) ...
-
bioRxiv - Neuroscience 2021Quote: ... which is an abundant splice isoform in human brain26 was engineered in the mammalian expression vector pIRES2-EGFP (BD Biosciences-Clontech, Mountain View, CA, USA). The EGFP-expressing vector was used for transfection of WT or variant KCNQ2 into CHO-Q3 cells (homozygous state) ...
-
bioRxiv - Pathology 2019Quote: ... adenoviral vectors expressing GFP (Ad-GFP) and human PERK (Ad-PERK) were constructed using a one-step Adeno-X-ZsGreen adenoviral system (632267; Takara Bio, Mountain View, CA) following manufacturer’s instruction ...
-
bioRxiv - Cancer Biology 2022Quote: Tgfb-Induced-Enhancer:Beta-globin-minimal-promoter-EGFP:pA pDestTol2pA2 was cloned by PCR amplifying the enhancer (chr1:22747452-22747734) in Figure 1A using A375 human melanoma gDNA (Forward primer: TTCTTTGTCATCCTGGTAGAGCAAATCGAG, Reverse primer: GACAGGTCGCACCTGAGTCC)(Advantage® 2 PCR Kit, Clontech #639207, Kyoto, Japan). PCR product was gel purified (Qiagen #28604 ...
-
bioRxiv - Cell Biology 2023Quote: ... downstream of the Myh6 (α- myosin heavy chain) promoter and upstream of a human growth hormone polyadenylation signal using In-Fusion HD (Takara Bio cat# 011614). The final transgenic targeting construct was verified by DNA sequencing ...
-
bioRxiv - Molecular Biology 2022Quote: ... the structural homologue regions from human and gecko EVX1AS were in vitro transcribed (IVT) using a T7 RNA Polymerase (Takara Bio, San Jose, CA). IVT lncRNAs were then purified ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... were subcloned into pCS2-3×Flag (Wang et al., 2017) or pmCherry-N1 and CDSs encoding CASP (pufferfish, human and mouse) were subcloned into p-CMV-Myc (Clontech, Mountain View, CA, USA) or pCS2-Myc (Wang et al. ...
-
bioRxiv - Microbiology 2020Quote: ... 250 ng of RNA isolated from each condition was converted into cDNA and processed through the SMARTer® 5’/3’ RACE Kit (Takara Bio) for 5’-RACE following manufacturer protocols ...
-
bioRxiv - Developmental Biology 2020Quote: ... templates were constructed by cloning the 2 kb 5’ and 3’ homology arms into pPD95.77 plasmids using In-Fusion Advantage PCR cloning kit (Clontech, cat. no. 639621). We used the CRISPR design tool (http://crispr.mit.edu ...
-
bioRxiv - Genomics 2020Quote: ... corresponding primers (Supplementary Table 3-4), Phanta Max Super-fidelity DNA Polymerase (Cat. No. P505-d1, Vazyme) or KOD plus (Cat. No. F0934K, Takara, Kyoto, Japan) with a touchdown cycling protocol that contains 30 cycles of 98 °C for 10 s ...
-
bioRxiv - Cancer Biology 2020Quote: ... Virus was collected after 24 hours for 3 consecutive days and concentrated with Lenti-X Concentrator (Takara Bio USA, Mountain View, CA). A mixture of two shRNA constructs for SPCA2 was used ...
-
bioRxiv - Immunology 2021Quote: ... The TSO was designed with two isodeoxynucleotides at the 5’ end to prevent TSO concatemerization and three riboguanosines at the 3’ end for increased binding affinity to the appended deoxycytidines (property of the Takara reverse transcriptase) (56 ...
-
bioRxiv - Biochemistry 2020Quote: Complementary DNA (cDNA) was generated from previously extracted total RNA (900 ng) using the SMARTER RACE 5’/3’ kit (Takara Bio USA) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2020Quote: ... were loaded into each well of a 384-well plate (A1 through D2) and dispensed 50nL per well into a 5,184 well SMARTer™ ICELL8® 3’ DE Chip (Takara Bio) using the ICELL8® Multisample NanoDispenser (MSND ...
-
bioRxiv - Cancer Biology 2020Quote: ... The ICELL8® 3’ DE Chip was placed on the ICELL8® MSND and loaded 50 µL of RT-PCR solution (Takara Bio ...
-
bioRxiv - Cell Biology 2021Quote: 5’ and 3’ RACE reactions were performed to isolate full-length lncEry from the total RNA of MEP cells using the 5’- and 3’-Full RACE Kits (TaKaRa, Dalian, China) in accordance with the manufacturer’s instructions ...
-
bioRxiv - Immunology 2021Quote: ... viral stocks were concentrated by adding supernatant at a 3:1 ratio to Lenti-X Concentrator (631232, Takara Bio, Mountain View, CA). Mixtures were incubated overnight at 4 °C ...
-
bioRxiv - Zoology 2019Quote: ... the cDNA ends of both genes were obtained via 5’- and 3’-RACE using the SMARTer™ RACE cDNA amplification kit (Clontech, USA). Resulting PCR products were directly sequenced and full-length cDNAs of the putative mudskipper desaturase and elongase were constructed by aligning overlapped regions of the cDNA fragments.
-
bioRxiv - Plant Biology 2021Quote: ... The yeast strain AH109 was used for the yeast two-hybrid assay according to MatchmakerTM Two-Hybrid System 3 (Clontech, Palo Alto) and grown on YPD (full medium ...
-
bioRxiv - Cell Biology 2021Quote: ... 5-AAC TTC GCG CTT CCT AAG TCC CCG AAG GA-3 using Prime STAR mutagenesis kit (Takara Bio Inc. Shiga, Japan). GFP-Rab27a was purchased from RikenBRC(Tsukuba ...
-
bioRxiv - Plant Biology 2021Quote: Yeast two-hybrid techniques were performed according to the yeast protocols handbook and the Matchmaker GAL4 Two-hybrid System 3 manual (both Clontech, Heidelberg, Germany) using the yeast reporter strains AH109 and Y187 ...
-
bioRxiv - Cancer Biology 2020Quote: ... Virus was collected after 24 hours for 3 consecutive days and concentrated with Lenti-X Concentrator (Takara Bio USA, Mountain View, CA). A mixture of two shRNA constructs for SPCA2 was used ...
-
bioRxiv - Developmental Biology 2019Quote: ... 3×Flag-Adnp or HA-Ctnnb1 were subcloned into pTRE3G or pLVX-tight-puro expression vector (Clontech, PT5167-1 and PT3996-5) using In-fusion HD cloning system (Clontech ...
-
bioRxiv - Physiology 2019Quote: cDNA library was prepared using SMART-Seq v4 3’ DE kit according to the manufacturer’s instructions (Clontech Laboratories Inc. Cat. No. 635040). For each clone ...
-
bioRxiv - Genetics 2020Quote: ... The 5’ and 3’ end of the viral genome was amplified by rapid amplification of cDNA ends by using the 5’ and 3’ Smarter RACE kit (TaKaRa, Dalian, China).
-
bioRxiv - Cell Biology 2021Quote: ... Sanger sequencing was performed after PCR amplification with appropriate primers (Fw#3 and Rv#4, S1 Table) and PrimeSTAR HS DNA Polymerase (Takara, Kyoto, Japan).
-
bioRxiv - Plant Biology 2022Quote: Direct protein-protein interaction was tested by Y2H technique according to the yeast protocols handbook and the Matchmaker GAL4 Two-hybrid System 3 manual (both Clontech, Heidelberg, Germany). Yeast strain Y190 was co-transformed with respective plasmids ...
-
bioRxiv - Plant Biology 2022Quote: ... cDNAs were synthesized using 3 µg each of the total RNA and PrimeScript 1st strand cDNA synthesis kit (Takara, Kusatsu, Shiga, Japan). Exon spanning primes were made ...
-
bioRxiv - Immunology 2022Quote: Extracted RNA was thawed on ice and converted to first strand complementary DNA (cDNA) using the SMARTer RACE 5’/3’ Kit (Takara Bio USA), as described by the manufacturer and a custom oligonucleotide that contained the template switch oligo and a unique molecular identifier (5’ TSO-UMI ...
-
bioRxiv - Evolutionary Biology 2023Quote: The 3’UTR sequence of CcTRPM gene was amplified by the 3’-Full RACE Core Set with PrimeScriptTM RTase kit (Cat# 6106, Takara, Kyoto, Japan). miRNAs for CcTRPM were predicted by a service provider LC science with two software programs of miRanda (http://www.microrna.org ...
-
bioRxiv - Microbiology 2023Quote: ... The cleared lysate was loaded onto a 25 mL free-flow gravity column (GeneFlow) packed with 3 ml TALON® Metal Affinity Resin (Takara Bio), washed with 10 column volumes (CV ...
-
bioRxiv - Cell Biology 2023Quote: ... Constructs that express wrmScarlet-tagged V-ATPase components with gfp::unc-54 3’ UTR were generated using the In-Fusion Advantage PCR cloning kit (Clontech, Cat. #639621). The primers were listed in Extended Data Table 3.
-
bioRxiv - Plant Biology 2024Quote: Yeast two-hybrid techniques were performed according to the yeast protocols handbook and the Matchmaker GAL4 Two-hybrid System 3 manual (both Clontech, Heidelberg, Germany) using the yeast reporter strains AH109 and Y187 ...
-
bioRxiv - Microbiology 2023Quote: ... reverse transcription of the RNA using a primer designed to the constant region of the barcoded adaptor with addition of an adapter to the 3’ end of the cDNA by template switching using SMARTScribe Reverse Transcriptase (Takara ClonTech #639538) as described92 ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: The Northern dot blots containing cDNAs from primary human tumors (T) with paired adjacent normal tissues (N) and cancer cell lines were obtained from Clontech (Cancer Profiling Array, #7840-1). The blots contained normalized cDNA isolated from tumors and the corresponding adjacent normal tissues from individual cancer patients ...
-
bioRxiv - Cancer Biology 2020Quote: ... Amplified cDNA from the ICELL8® 3’ DE Chip individual cells was collected and pooled using the ICELL8® Collection Kit (Takara Bio) by centrifugation at 3,200 x g ...
-
bioRxiv - Microbiology 2021Quote: 5’-RACE PCR was performed on total RNA from VSVg-NL43 infected CD4+ T cells and MDMs following the manufacturer’s protocol for SMARTer® RACE 5’/3’ Kit (Takara Bio, Cat: 634858). Random primers were annealed to template RNA using 10X Random Primer Mix ...
-
bioRxiv - Microbiology 2020Quote: pEX18Tc-hpdA was constructed for gene knockout by fusing the erythromycin resistance gene and two upstream and downstream fragments of the target gene amplified with the primers shown in Table 3 to Sac I/Hind III-digested pEX18Tc with the In-Fusion® HD Cloning Kit (TaKaRa, Dalian, China). The resulting plasmid pEX18Tc-hpdA was transformed into E ...
-
bioRxiv - Systems Biology 2022Quote: Following the transfer of samples into a 384-well plate containing RT-PCR buffer with 3’ SMART-Seq CDS Primer IIA (SMART-Seq® v4 PLUS Kit, TaKaRa, cat# R400753); the samples were immediately denatured at 72ºC for 3 min and chilled on ice for at least 2 min ...
-
bioRxiv - Plant Biology 2021Quote: Transcription start sites were characterised by cloning and sequencing 5’ RACE products using the SMARTer RACE 5’/3’ kit (Takara Bio USA, Inc). In summary ...
-
bioRxiv - Developmental Biology 2022Quote: ... 5’ and 3’ RACE ready cDNA was generated from a pooled female pupal RNA sample and also from a pooled adult female ovary sample (RNA extracted using RNeasy MinElute kit, RACE conducted using SMARTer 5⍰/3⍰ RACE kit - Takara Bio, Kyoto, Japan). Visible bands were cloned using the NEB PCR cloning kit (New England Biolabs ...
-
bioRxiv - Microbiology 2019Quote: ... flanked by a 5’ terminal Kozak sequence and 3’ terminal stop codon into the Nhe1 and Sal1 sites of pIRES2-EGFP (Clontech cat # 6029-1).
-
bioRxiv - Microbiology 2019Quote: ... reverse transcription of the RNA using a primer designed to the constant region of the barcoded adaptor with addition of an adapter to the 3’ end of the cDNA by template switching using SMARTScribe (Clontech, Mountain View, C.A.) as described (44) ...