Labshake search
Citations for Takara Bio :
851 - 900 of 959 citations for Kallikrein 3 PSA Human HEK293 His since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: Mouse NIH/3T3 (ATCC, cat# CRL-1658), human IMR-90 (ATCC, cat# CCL-186) and Lenti-X™ 293T (Takara Bio, cat# 632180) cell lines were cultured in full-DMEM (Corning ...
-
bioRxiv - Cell Biology 2024Quote: ... A bicistronic construct expressing human EPAC1b with a C-terminal His10 tag and SUMO3(Q89K) was constructed using the pIRES2-EGFP vector (Clontech Catalog no. 632435). The EPAC1-His10-IRES-SUMO3(Q89K ...
-
bioRxiv - Neuroscience 2022Quote: Human embryonic stem cell (hESC)-derived cerebral organoids (hCOs) were generated from a commercially available hESC stem cell line (Takara Bio, Osaka, Japan), using the STEMdiff cerebral organoid kit (STEMCELL Technologies ...
-
bioRxiv - Cancer Biology 2023Quote: ... and 1.25Lμg pVSV-G (second-generation lentivirus packaging system) into human embryonic kidney packaging cells GP2-293 (Clontech, Inc., Mountain View, CA, USA), using CalPhos™ Mammalian Transfection Kit (Clontech ...
-
bioRxiv - Microbiology 2021Quote: ... and a linker sequence (5’-GGTAGCGGCAGCGGTAGC-3’) were added through three additional PCR reactions using PrimeStar GXL DNA polymerase (Takara Bio). PCR products were gel-purified in each step ...
-
Three Distinct Transcriptional Profiles of Monocytes Associate with Disease Activity in SSc PatientsbioRxiv - Genomics 2022Quote: ... Full-length RNA-seq libraries from CM and skin macrophages were prepared from ∼3 ng of total RNA using SMART-Seq v4 Ultra Low Input RNA Kit (Clontech Laboratories) followed by Nextera XT protocol (Illumina) ...
-
bioRxiv - Genomics 2020Quote: ... Transcripts rising from the identified TSS were determined using the SMARTer Rapid amplification of cDNA ends (RACE) 5’/3’ kit (Takara Bio) in accordance with the manufacturer’s instructions for 3’ RACE ...
-
bioRxiv - Developmental Biology 2019Quote: ... 5’ and 3’ RACE was carried out according to the manufacturer’s protocol of SMART RACE cDNA Amplification kit (Clontech, Takara, Japan). The sequences of primers for RACE are as follows ...
-
bioRxiv - Cell Biology 2019Quote: ... was extracted and 5’ and 3’ rapid amplification of cDNA ends (RACE) was performed using the Smarter RACE kit (Clontech, 634858). cDNA was synthesized as described in the kit using 5′ and 3′ RACE CDS primers and SMARTer IIA oligo for template switching for 5′ RACE ...
-
bioRxiv - Immunology 2021Quote: ... the isolated RNAs were subjected to first-strand cDNA synthesis using (5’-GTCGTATCCAGTGCAGGGTCCGAGGTCACTG GATACGACATACAACA-3’) by PrimeScriptTM II 1st Strand cDNA Synthesis Kit (Takara, Japan). After that ...
-
bioRxiv - Genomics 2020Quote: ... the ORFs of all KRAB-transposase fusions except for KRABINER were synthesized as gBlocks (IDT) with 15bp of homology on the 5’/3’ end to facilitate In-Fusion cloning (Clontech, #638920) into either the pcDNA3.1+ (Addgene #V790-20 ...
-
bioRxiv - Cancer Biology 2021Quote: ... DAPI stained nuclei were diluted to a concentration of 60,000 cell/mL in 1x PBS + 1% BSA + 1x Second Diluent + 0.2U SUPERase·In RNase Inhibitor and dispensed onto the ICELL8 3 ‘DE Chip (Takara Bio, Cat# 640143) using the ICELL8 MultiSample NanoDispenser ...
-
bioRxiv - Biophysics 2022Quote: ... and slowly shaken with all-trans-retinal (added to a final concentration of 25 μM) in the dark at room temperature for 3–4 h in the presence of 0.5 % of Westase (Takara Bio, Inc.) to digest the cell wall ...
-
bioRxiv - Cell Biology 2021Quote: ... zroraa LBD deletion DN -: 5′- ctgattatgatctagagtccaggccggattgatcagg-3 and inserted into a Tol2-lyzC-mcherry-2A backbone by using infusion cloning kit (Takara #638920). The construction method for neutrophil-specific Cas9 expression and the guide RNA expression fish lines has been described in our previous study [40] ...
-
bioRxiv - Neuroscience 2020Quote: Total RNA was extracted from tissues of 13-month-old wildtype C57BL/6J mice (n=3) using RNAiso Plus (Takara Bio). Complementary DNA (cDNA ...
-
Lateral organ diversification in plants mediated by the ALOG protein family of transcription factorsbioRxiv - Plant Biology 2019Quote: ... an MpTAW1 genomic fragment with a 10 kb upstream region and a 3 kb downstream region was amplified by PCR using Prime STAR GXL polymerase (TaKaRa, Japan) and subcloned into pENTR/D-TOPO (Thermo Fisher Scientific ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... The GFP coding sequence was ligated to the 3’ end of the SLC22A24 ortholog cDNA in the expression vector pcDNA5/FRT using In-Fusion HD cloning kit (ClonTech #639642). The human SLC22A24 GFP fusion construct was purchased from OriGene (Catalog number ...
-
bioRxiv - Genomics 2020Quote: ... The cDNA synthesis was carried out by using 5 g of total RNA or 1 g of PAPed RNA with RT primer (5-TTTTTTTTUUUTTTTTVN-3) by PrimeScript II Reverse Transcriptase (TaKaRa Bio). The full-length cDNAs were selected by Cap Trapper method 60 ...
-
bioRxiv - Neuroscience 2019Quote: ... HeLa cells were transfected with 3 μg of the designated construct or empty plasmid (see below) using the CalPhos transfection kit (Clontech, 631312). HeLa cells were used 48 h after transfection.
-
bioRxiv - Microbiology 2020Quote: ... The 5’ RACE reaction was performed with an ac13-specific primer (ac13-GSP1) using a SMARTer® RACE 5’/3’ Kit (TaKaRa) according to the manufacturer’s protocol ...
-
bioRxiv - Genomics 2020Quote: ... was linearized from the 3’LTR to the RRE by PCR and both PCR products were fused using In-Fusion Cloning (Takara Bio) and transformed into One Shot Stbl3 Chemically Competent E.coli (Life Technologies) ...
-
bioRxiv - Plant Biology 2022Quote: ... followed by selection of transformants and testing of pair-wise interactions by growth complementation assays on nutrient selection media as described in the Matchmaker™ GAL4 Two-Hybrid System 3 manual (Clontech). To compensate for auto-activation of some constructs ...
-
bioRxiv - Zoology 2023Quote: ... Primers were designed on each contig (Table S3) and RT-PCR was performed using a 3’ RACE CORE Set (Takara Bio).
-
bioRxiv - Microbiology 2022Quote: ... the 3′ terminus of each strand of dsRNA was ligated with PC3-T7loop oligo (Table S1) using T4 RNA ligase (TaKaRa, China) at 16 °C for 16 h ...
-
bioRxiv - Molecular Biology 2022Quote: Synthesis of cDNA with biotinylated 3’ adaptor ligation was performed using a Small RNA Cloning Kit (Takara Bio Inc., Kusatsu, Japan) as previously reported (20 ...
-
bioRxiv - Neuroscience 2022Quote: Jacob-LMO4 interaction was reconfirmed using fusion vectors (bait vector pGBKT7, prey vector pGADT7) using MATCHMAKER Two-Hybrid System 3 (Takara Bio Europe/Clontech, France). Co-transformed yeasts were assayed for growth on quadruple drop-out medium (SD/–Ade/–His/–Leu/–Trp ...
-
bioRxiv - Microbiology 2023Quote: ... reverse transcription of the RNA using a primer designed to the constant region of the barcoded adaptor with addition of an adapter to the 3’ end of the cDNA by template switching using SMARTScribe Reverse Transcriptase (Takara ClonTech #639538) as described92 ...
-
bioRxiv - Molecular Biology 2024Quote: ... the U2OS 2-6-3 cells expressing degron-tagged LacI fusion proteins were incubated with 300 nM Shield1 ligand (Takara Bio) and 1 µg/mL doxycycline for 24 hours ...
-
bioRxiv - Biophysics 2023Quote: ... 5’-CTGGAGAATCCCGGTGC-3’ and 5’- GTGTCAGATATATACATCCTGT-3’ and the PCR product was purified using a NucleoSpin Gel and PCR Clean-up Maxi kit (Takara Bio). The sequences of the 147 bp and 177 bp DNA are as follows:
-
bioRxiv - Cancer Biology 2023Quote: ... and clonally isolated p53 KO cell lines were electroporated with 3 µg p53 firefly luciferase reporter plasmid pp53-TA-Luc (Clontech/Takara) and 0.3 ug renilla luciferase control plasmid pRL-CMV (Promega ...
-
bioRxiv - Microbiology 2023Quote: ... These identical sequences were generated via PCR with primers that contain a 5’ end identical to an adjacent segment and a 3’ end that anneals to the gene-of-interest sequence using a 2x hot-start PCR master mix (Takara, #R405A). The primers for PCR reactions were listed in Table 2.
-
bioRxiv - Neuroscience 2023Quote: Artificially synthesized (G4C2)50 sequences flanked at the 5′ end with an EagI recognition site and at the 3′ end with a PspOMI recognition site were subcloned into T-vector pMD20 (Takara Bio). To generate a longer repeat size ...
-
bioRxiv - Molecular Biology 2023Quote: ... Promoterless bicistronic vectors were generated by removing the SV40 promoter from the bicistronic vector pRUF and the pRUF vectors containing the putative IRES sequences by PCR amplification using divergent primers (Supplementary Table 3) and the CloneAmp™ HiFi PCR Premix (Takara) polymerase ...
-
bioRxiv - Immunology 2023Quote: ... Lentivirus-containing supernatant was harvested on days 2 and 3 after transfection and then concentrated using a Lenti-X concentrator (Clontech, 631232). HEK-293T cells were transfected with the expression vectors according to the manufacturer’s protocol with PEI 2500 (BioScientific) ...
-
bioRxiv - Cell Biology 2023Quote: ... the University of North Carolina at Chapel Hill) (43) and inserted back into pIZ-Msps-GFP digested with SspI(5’) and XhoI(3’) using Infusion ligation (Takara Bio) to create pIZ-Msps (RNAi-resistant)-GFP ...
-
bioRxiv - Biochemistry 2023Quote: ... Affinity purification of Ypq1-3C-GFP-8xHis was done by incubating the supernatant with 3 mL TALON cobalt resin (635502; TaKaRa Bio) pre-equilibrated with Column buffer (20 mM HEPES-KOH (pH 7.2) ...
-
bioRxiv - Neuroscience 2023Quote: ... The resulting PCR product was cloned between the 3’ and 5’ arms of the Rosa26 targeting vector using In-Fusion cloning (Takara Bio). Plasmid sequence was checked by sequencing ...
-
bioRxiv - Plant Biology 2023Quote: ... the correct full-length sequences were determined for the laboratory strains using a SMARTer RACE 5’/3’ kit (Takara, Shiga, Japan). These sequences were aligned by ClustalW ...
-
bioRxiv - Cancer Biology 2023Quote: ... Three RNA lysis aliquots of the LC6 sample were processed and library preparation completed on the 3 aliquots with SMART-Seq® HT Kit (Takara) and Illumina Nextera reagents for tagmentation ...
-
bioRxiv - Neuroscience 2023Quote: ... the SV40pA was replaced by the 3’UTR of msSOD2 (Kaltimbacher et al., 2006) amplified from mouse brain cDNA (Clontech 637301) using primers AA35 and AA36 and inserted into the XbaI and NotI sites ...
-
bioRxiv - Evolutionary Biology 2023Quote: Complete cDNA sequences of taste receptors were obtained using a SMARTer 5’/3’ kit for RACE PCR to obtain 5’ sequence information missing from reference transcriptome (Takara, #634858). Briefly ...
-
bioRxiv - Cell Biology 2024Quote: Arrayed slides were blocked in PBST containing 3% (w/v) powdered milk within an Atlas Glass Hybridisation Chamber (Clontech, CA, USA) then hybridised to 400µl fluorophore-tagged peptide for 1 hour ...
-
bioRxiv - Neuroscience 2024Quote: ... D9891)-inducible adenoviral constructs were generated for Halo-TRIM9 and UNC5C-pHmScarlet using the adeno-X™ system 3 (Takara Bio, 631180), using the detailed protocol outlined by (O’Shaughnessy et al. ...
-
bioRxiv - Neuroscience 2022Quote: ... Constructs for human Tara were prepared by cloning full-length TRIOBP1 (Trio and F-actin binding protein1) isoform into pEGFP-C3 (Clontech, Mountain View, CA, USA), pFLAG-CMV2 (Sigma-Aldrich) ...
-
bioRxiv - Neuroscience 2021Quote: ... which is an abundant splice isoform in human brain26 was engineered in the mammalian expression vector pIRES2-EGFP (BD Biosciences-Clontech, Mountain View, CA, USA). The EGFP-expressing vector was used for transfection of WT or variant KCNQ2 into CHO-Q3 cells (homozygous state) ...
-
bioRxiv - Pathology 2019Quote: ... adenoviral vectors expressing GFP (Ad-GFP) and human PERK (Ad-PERK) were constructed using a one-step Adeno-X-ZsGreen adenoviral system (632267; Takara Bio, Mountain View, CA) following manufacturer’s instruction ...
-
bioRxiv - Cancer Biology 2022Quote: Tgfb-Induced-Enhancer:Beta-globin-minimal-promoter-EGFP:pA pDestTol2pA2 was cloned by PCR amplifying the enhancer (chr1:22747452-22747734) in Figure 1A using A375 human melanoma gDNA (Forward primer: TTCTTTGTCATCCTGGTAGAGCAAATCGAG, Reverse primer: GACAGGTCGCACCTGAGTCC)(Advantage® 2 PCR Kit, Clontech #639207, Kyoto, Japan). PCR product was gel purified (Qiagen #28604 ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... were subcloned into pCS2-3×Flag (Wang et al., 2017) or pmCherry-N1 and CDSs encoding CASP (pufferfish, human and mouse) were subcloned into p-CMV-Myc (Clontech, Mountain View, CA, USA) or pCS2-Myc (Wang et al. ...
-
bioRxiv - Cell Biology 2023Quote: ... downstream of the Myh6 (α- myosin heavy chain) promoter and upstream of a human growth hormone polyadenylation signal using In-Fusion HD (Takara Bio cat# 011614). The final transgenic targeting construct was verified by DNA sequencing ...
-
bioRxiv - Molecular Biology 2022Quote: ... the structural homologue regions from human and gecko EVX1AS were in vitro transcribed (IVT) using a T7 RNA Polymerase (Takara Bio, San Jose, CA). IVT lncRNAs were then purified ...