Labshake search
Citations for Takara Bio :
651 - 700 of 922 citations for Kallikrein 3 PSA Human HEK293 His since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2023Quote: ... FL-human KANK1 (generous donation from the Bershadsky lab) cDNA was tagged in the C-terminal site with pmCherry (Clontech) by restriction digestion ...
-
bioRxiv - Cell Biology 2023Quote: ... The DNA fragments encoding human zyxin were amplified from the cDNA of U2OS cells and then inserted into the pmCherry-N1 vector (Clontech) for the expression of zyxin-RFP.
-
bioRxiv - Cell Biology 2023Quote: ... The PISD-FLAG plasmid was generated by amplifying human PISD from cDNA and cloning it into the BglII and SalI sites of the pmCherry-N1 vector (Clontech). The C-terminal mCherry tag was subsequently replaced with 3xFLAG tag using the AgeI and NotI restriction sites ...
-
bioRxiv - Developmental Biology 2023Quote: ... Quantitative RT-PCR for pluripotency and trilineage spontaneous differentiation was performed according to the instruction manual of the human ES cell Primer Array (Takara Clontech).
-
bioRxiv - Cell Biology 2023Quote: ... mEmerald/ mApple -VTA1: full-length human VTA1 was amplified by PCR and cloned to mEmerald or mApple -C1 vectors (Clontech). mCh-CHMP4C ...
-
bioRxiv - Cell Biology 2024Quote: A PCR product containing the Human ORF for DDX3X was obtained directly from RNA using the Primescript High Fidelity RT-PCR kit from Takara. The PCR primers introduced BamHI and NotI sites at the 5’ and 3’ ends respectively ...
-
bioRxiv - Synthetic Biology 2024Quote: WT Human Embryonic Kidney (HEK) 293 cells (ATCC, catalog no. CRL-1573) and HEK293T-LentiX (Takara Biosciences, catalog no. 632180) were cultured in a humidity-controlled incubator under standard culture conditions (37 °C with 5% CO2 ...
-
bioRxiv - Immunology 2023Quote: ... cDNA libraries were generated using SMARTer Human TCR a/b Profiling Kit v2 (Takara Bio USA, San Jose, California, USA). Briefly ...
-
bioRxiv - Systems Biology 2024Quote: SW1353 cells were purchased from ATCC Full length miRNA target 3’UTRs were amplified from human genomic DNA using PCR primers (Supplementary Table 4) to enable Clontech In-Fusion HD cloning (Takara Bio Europe ...
-
bioRxiv - Cell Biology 2020Quote: ... and the 3’- M6 fragment and the sfGFP fragment were inserted using In-fusion cloning (homologous recombination; TaKaRa). The resulting M6-sfGFP insert was excised using NotI and KpnI and ligated into pUASt-attB [38] ...
-
bioRxiv - Developmental Biology 2021Quote: ... and 3⍰×⍰105 cells were reverse transfected with 2μg of UniSAM DNA using the Xfect Transfection reagent (Clontech) and plated into a coated 6 well plate ...
-
bioRxiv - Microbiology 2020Quote: ... cDNA was generated following the SMARTer® 5’/3’ RACE kit protocol (Takara Bio, Kusatsu, Shiga Prefecture, Japan).
-
bioRxiv - Biochemistry 2020Quote: ... These 3 fragments were inserted between the KpnI site and the NheI site in pPBH-TREtight by Clontech In-Fusion® Cloning Kit to get pPBH-TREtight-FRB-eDHFR-(ER/K)20nm -EGFP-FKBP12.
-
bioRxiv - Biochemistry 2020Quote: ... These 3 fragments were inserted between the KpnI site and the NheI site in pPBH-TREtight by Clontech In-Fusion® Cloning Kit to get pPBH-TREtight-FRB-eDHFR-(ER/K)30nm-EGFP-FKBP12.
-
Plant pathogens convergently evolved to counteract redundant nodes of an NLR immune receptor networkbioRxiv - Plant Biology 2021Quote: ... 3 μl of each dilution was then spotted on a SD-Leu-Trp plate (ST0048, Takara Bio, USA) as a growth control ...
-
bioRxiv - Cancer Biology 2020Quote: ... After incubation membrane was washed with 1X TBST buffer 3 times and detected with ECL reagent (TAKARA, Japan) using Versa Doc (BD Bioscience ...
-
bioRxiv - Cell Biology 2020Quote: ... The 10 amino acid duplication 3’ to GFP or mCherry2 on SHH protein was introduced using Infusion (Clontech) using primers (forward 5’TCCGGCGGCAGATCTGCAGAGAACTCCGTGGCGGCCAAATCCGGCGGCTGTTTCCCGG GA and reverse 5’ tcccgggaaacagccgccggatttggccgccacggagttctctgcagatctgccgccgga) ...
-
bioRxiv - Molecular Biology 2022Quote: ... A 25 nt poly(A) sequence was inserted after the 3’ UTR using the In-Fusion (Takara Bio) method.
-
bioRxiv - Cell Biology 2022Quote: ... Flt3 ligand (50 ng/ml) and IL-3 (20 ng/ml) onto plates coated with retronectin (Takara Bio).
-
bioRxiv - Developmental Biology 2022Quote: Rapid amplification of cDNA end (RACE) was performed using the SMARTer® RACE 5’/3’ Kit (Takara, #634858). 1ug of freshly isolated RNA from E8.5 embryo hearts was used to generate first strand cDNA according to the manufactural protocol ...
-
bioRxiv - Genetics 2022Quote: ... Total protein was harvested after 3 days of culture and analyzed by Western blot (mouse anti-DsRed, Clontech; rabbit anti-POU6F2 ...
-
bioRxiv - Plant Biology 2022Quote: ... and histidine (H) and containing 5-Bromo-4-Chloro-3-Indolyl α-D-galactopyranoside (X-α-gal) (Clontech) to detect interactions ...
-
bioRxiv - Cell Biology 2022Quote: ... and in-chip reverse transcription PCR were performed using a 3’ DE Chip and Reagent kit (Takara Bio) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: ... filtered through 0.45 μm syringe filters (Starlab) and concentrated using 1/3 volume of Lenti-X concentrator (Clontech) as per the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... the single-stranded DNA (5’-AATTCAAAGAATTAACCTTAATTGAA GGGGAGGGTTCAGTACTTTTGTGTAGTACAAATATCAGTACTTTTGTGTAGTACAAAA GGGAGGGCTTCAATTAAGGTTAATTCTTTG-3’) was treated with T4 DNA ligase (Takara, Beijing, China) after annealing ...
-
bioRxiv - Microbiology 2023Quote: ... 5’RACE was performed with SMARTer RACE 5’/3’ Kit (Takara Bio USA, Inc. San Jose, CA USA) according to the manufacturer’s directions.
-
bioRxiv - Molecular Biology 2023Quote: ... The 5’ and 3’ ends of the cDNA were amplified using the SMARTer RACE cDNA Amplification Kit (Clontech) according to the manufacturer’s guidelines ...
-
bioRxiv - Cell Biology 2023Quote: The full-length cDNA expression library was constructed using the SMARTer RACE 5’/3’ Kit (Takara Bio, 634858) according to the manufacturer’s instructions for the In-Fusion SMARTer Directional cDNA Library Construction Kit (Takara Bio ...
-
bioRxiv - Bioengineering 2024Quote: ... CD11b-specific amplicons were generated via 3-step nested PCR using PrimeSTAR GXL (Takara Bio, Kusatsu, Shiga, Japan) according to the manufacturer’s protocol with a 60°C annealing temperature ...
-
bioRxiv - Cancer Biology 2024Quote: ... Retroviral transduction was achieved by spinoculation of 3 × 106 mouse T cells on retronectin-coated plates (Takara Bio) with neat retroviral supernatant harvested from 293T packaging cells (2000xg ...
-
bioRxiv - Plant Biology 2024Quote: ... and inserted into BamHI-digested pGEX-4T-3 by using In-Fusion Smart Assembly Cloning Kit (Takarabio-Clontech). Full-length OcKSL4 cDNA was amplified by RT-PCR using primers 5’-GGATCCATGGCGAATTATCCCATGGAG-3’ (forward ...
-
bioRxiv - Cancer Biology 2024Quote: ... we employed the MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) or WST-1 (Water-Soluble Tetrazolium 1) assay from Takara, Japan ...
-
bioRxiv - Genomics 2019Quote: ... We additionally PCR amplified the region from genomic DNA for sample NA12878 with 12 copies of AC (NIGMS Human Genetic Repository, Coriell) using PrimeSTAR max DNA Polymerase (Clontech R045B) and primers RFT1eSTR_F and RFT1eSTR_R (Supplementary Table 8 ...
-
bioRxiv - Cell Biology 2019Quote: ... was produced by cloning a gene block (IDT) comprising a human codon optimized C10 Δ(45 - 69) into a YFP-N1 vector (Clontech) digested with NotI and BamHI to replace the YFP insert ...
-
bioRxiv - Neuroscience 2020Quote: Bacterial expression plasmids encoding mouse and human WT-α-synuclein in the inducible pRK172 backbone were transformed into BL21-CodonPlus (DE3) cells (Clontech). Cell pellets were lysed in 0.75M NaCl ...
-
bioRxiv - Cell Biology 2021Quote: Plasmids for the pull-down assay were constructed by cloning human Kif7 and Gli2 sequences into pCMV-BICEP™-4 expression vector followed by truncations using InFusion HD Cloning Kit (Takara). Kif7 fragments were cloned at the MCS1 to express FLAG-tagged Kif7 protein and Gli2 fragments were cloned at the MCS2 to express c-myc-tagged Gli2 protein ...
-
bioRxiv - Molecular Biology 2019Quote: ... PCGF1-4) and CBX1-8 cDNAs were amplified from human ES cell cDNA library and inserted to pGAD-T7 (Takara, 630442) and pGBK-T7 (Takara ...
-
bioRxiv - Molecular Biology 2020Quote: ... Illumina data from human HEK293T cells were processed with the SMARTer® smRNA-Seq Kit for Illumina (Takara, Cat. Nos. 635029) following guidelines ...
-
bioRxiv - Genetics 2021Quote: Gene expression profiling of 297 genes from IBD-associated loci was performed across a panel of different RNAs from human tissues (n=1, purchased from Clontech Laboratories) and from different immortalized intestinal and immune cell lines (n=3 ...
-
bioRxiv - Neuroscience 2021Quote: Plasmids encoding GST-BVR (GST-BVRα) and GST-BVRβ were generated by cloning cDNA of human BLVRA and BLVRB into pCMV-GST vector (Clontech/TaKaRa). The construct encoding myc-FAK was generated as previously described (95) ...
-
bioRxiv - Neuroscience 2021Quote: The desired ORF for Pdlim7 (Gene bank ID: AF345904.1) was amplified by PCR from Human Universal QUICK-Clone™ II (Takara 637260) using primers depicted in Table S2 and inserted into pEGFP-C1 plasmid through Gibson assembly.
-
Heat Shock Factor 1 (HSF1) as a new tethering factor for ESR1 supporting its action in breast cancerbioRxiv - Cancer Biology 2021Quote: The shRNA target sequence for human HSF1 (NM_005526.4) was selected using the RNAi Target Sequence Selector (Clontech, Mountain View, CA, USA). The target sequences were ...
-
bioRxiv - Microbiology 2021Quote: ... Phage libraries were constructed using antibody gene fragments amplified from PBMCs of 50 healthy human subjects (Allcells, PB003F and PB003C) and total RNA from PBMCs (TaKaRa, 636592), spleens (TaKaRa ...
-
bioRxiv - Cell Biology 2023Quote: The plasmid pEGFP-N1–VMP1 was obtained by inserting the human VMP1 sequence (NCBI reference sequence: NM_030938.5) into pEGFP-N1 (CLONTECH cat. #6085-1). The plasmid pcDNA4-B–hVMP1–V5/His was obtained by inserting the human VMP1 sequence (NM_030938.5 ...
-
bioRxiv - Molecular Biology 2023Quote: ... and CDS of fluorescent proteins were subcloned into pET-human αSyn51 using the KOD-Plus Mutagenesis kit (TOYOBO) and In-Fusion HD Cloning Kit (Takara Bio) according to the manufacturers’ protocol ...
-
bioRxiv - Cell Biology 2023Quote: ... The coding sequence of EPHX2 was amplified by PCR from liver cDNA (Human Multiple Tissue cDNA panels; Takara Bio, Shiga, Japan) using primers (5’-GTCGACATGACGCTGCGCGCGGCCGTCTTCG-3’ ...
-
bioRxiv - Developmental Biology 2023Quote: ... Quantitative RT-PCR for pluripotency and trilineage spontaneous differentiation was performed according to the instruction manual of the human ES cell Primer Array (Takara Clontech).
-
bioRxiv - Biochemistry 2023Quote: Mouse UCP1 gene and human codon-optimized mitoLbNOX and LbNOX (addgene #74448 and #75285) were cloned into pLVX-TRE3G vector (Clontech, CA) using Gibson assembly ...
-
bioRxiv - Cell Biology 2020Quote: ... cells were single-cell sorted into 96-well low-bind PCR-plates [Eppendorf] containing 3 μl of lysis buffer (0.5 units/μl RNase inhibitor [Takara] ...
-
bioRxiv - Developmental Biology 2021Quote: ... was incubated with antibodies at 4°C for one hour: 3 µl (0.5 µg/µl) c-Myc monoclonal antibody (Cat. No. 631206, TaKaRa), or 1 µl (1.1 µg/µl ...