Labshake search
Citations for Takara Bio :
851 - 900 of 1209 citations for Human MMP24 shRNA Plasmid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2022Quote: ... This sequence was cloned into the EcoRI-NotI sites of the modified plasmid 61591 using In-Fusion cloning (Takara). The ‘empty vector’ control contained CMV-promoter driven dSaCas9-KRAB but no guide sequences ...
-
bioRxiv - Microbiology 2022Quote: ... using specific primers flanked by 15bp overlapping regions from pL6-var2csa-promoter-deletion plasmid and pUF1_Cas9 (list of primers, see Supplementary Table S8) that allowed the cloning by infusion cloning (Clontech, Takara Bio USA ...
-
bioRxiv - Microbiology 2022Quote: ... PCR amplification from genomic and plasmid DNA templates was performed using PrimeStar Max DNA polymerase (Takara Bio, Kusatsu, Japan) or GoTaq Master Mix (Promega ...
-
bioRxiv - Bioengineering 2023Quote: ... was cloned into the prey vector pPR3-N and co-transformed into yeast strain NMY51 cells together with pDHBⅠ-GhERF105a plasmid according to the Matchmaker user’s manual protocol (Clontech). Yeast transformants were selected by growth on synthetic dropout nutrient medium SD/-Leu/-His/-Ade/-Trp (Clontech ...
-
bioRxiv - Cell Biology 2022Quote: ... Mav203 was transformed with four plasmids and spread onto Sc-LeuTrpUra plates containing 0.5 μg/ml Aureobasidin A (TAKARA).
-
bioRxiv - Microbiology 2022Quote: ... 293T cells were co-transfected with the aforementioned lentiviral vector plasmid and Lentiviral High Titer Packaging Mix (Takara Bio).
-
bioRxiv - Microbiology 2023Quote: ... to ligate the variant insert pool into BsmBI-digested pHW2000 plasmid and transformed Stellar™ Competent Cells (Takara, #636763) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: AAV transfer plasmids were constructed by removing all the sequences between the ITRs of the pAAV-CMV vector (TaKaRa) and inserting the Mhck7 promoter ...
-
bioRxiv - Bioengineering 2023Quote: ... following which these sequences were inserted into the parental plasmid using In-Fusion® cloning kit (Takara Bio Inc.).
-
bioRxiv - Immunology 2023Quote: ... All expression plasmids for transient expression were cloned into the pCS2+ vector backbone and cloned using InFusion HD (Clontech). Constitutive lentiviral expression was performed using pCDH vector constructs (System Biosciences ...
-
bioRxiv - Molecular Biology 2023Quote: Expression plasmids for fusion proteins of GFP and tardigrade proteins were constructed by Gibson assembly into pEGFP-N1 (Clontech) of the tardigrade cDNA (obtained by gene synthesis from Integrated DNA ...
-
bioRxiv - Synthetic Biology 2023Quote: A 10 cm dish of HEK293T cells that had been transfected with the GFP expressing plasmid pEGFP-N1 (Clontech) was washed with PBS and lysed by sonication on ice in PBS supplemented with 0.2 % Triton X100 ...
-
bioRxiv - Neuroscience 2023Quote: ... Plasmid DNA used to generate lentiviral particles were transfected into HEK293 cells using LentiX single-shot VSV-G (Takara) following manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... coli BL21 (DE3) containing a pGro7 plasmid for overexpression of the GroEL/ES chaperone system (Takara Bio, Shiga, Japan). ACP (acyl phosphatase ...
-
bioRxiv - Biophysics 2023Quote: ... All remaining unsorted cells in addition to the sorted cell populations were then miniprepped (Takara NucleoSpin Plasmid miniprep kit), and DNA was stored at 4 °C short-term or at −20 °C for long-term storage.
-
bioRxiv - Biochemistry 2023Quote: The plasmids of TiCGSCy mutants (E1442Q, E1442A and E1356A) were constructed using a PrimeSTAR mutagenesis basal kit (Takara Bio) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... Heparan sulfate sulfotransferase genes (in pDONR223 from the ORFeome v8.1 collection (Dharmacon)) were cloned by LR reaction (ThermoFischer Scientific) into mammalian expression plasmid pDest-eGFP-N1 (Clontech) according to the manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2024Quote: ... All the other plasmids used in this study are cloned by following the standard protocol of Infusion HD (Takara).
-
bioRxiv - Developmental Biology 2024Quote: ... 5xmyc-RPGRIP1L cDNA was amplified from the plasmid pCS2-5xmyc-RPGRIP1L (23) using CloneAmp HiFi PCR Premix (Takara # 639298) using primers ...
-
bioRxiv - Cell Biology 2024Quote: ... two PCRs were performed using li-Strep_ss-SBP-EGFP-Ecadherin (a gift plasmid from F. Perez) (Boncompain et al., 2012) and pEGFP-C1 (Clontech) as templates and the following primer pairs (GAT GCA CCC GGG AGG CGC GCC ATG and CTC CTC GCC CTT GCT CAC ACC TGC AGG TGG TTC ACG ...
-
bioRxiv - Genomics 2019Quote: ... We additionally PCR amplified the region from genomic DNA for sample NA12878 with 12 copies of AC (NIGMS Human Genetic Repository, Coriell) using PrimeSTAR max DNA Polymerase (Clontech R045B) and primers RFT1eSTR_F and RFT1eSTR_R (Supplementary Table 8 ...
-
bioRxiv - Cell Biology 2019Quote: ... was produced by cloning a gene block (IDT) comprising a human codon optimized C10 Δ(45 - 69) into a YFP-N1 vector (Clontech) digested with NotI and BamHI to replace the YFP insert ...
-
bioRxiv - Cell Biology 2021Quote: Plasmids for the pull-down assay were constructed by cloning human Kif7 and Gli2 sequences into pCMV-BICEP™-4 expression vector followed by truncations using InFusion HD Cloning Kit (Takara). Kif7 fragments were cloned at the MCS1 to express FLAG-tagged Kif7 protein and Gli2 fragments were cloned at the MCS2 to express c-myc-tagged Gli2 protein ...
-
bioRxiv - Molecular Biology 2019Quote: ... PCGF1-4) and CBX1-8 cDNAs were amplified from human ES cell cDNA library and inserted to pGAD-T7 (Takara, 630442) and pGBK-T7 (Takara ...
-
bioRxiv - Molecular Biology 2020Quote: ... Illumina data from human HEK293T cells were processed with the SMARTer® smRNA-Seq Kit for Illumina (Takara, Cat. Nos. 635029) following guidelines ...
-
bioRxiv - Genetics 2021Quote: Gene expression profiling of 297 genes from IBD-associated loci was performed across a panel of different RNAs from human tissues (n=1, purchased from Clontech Laboratories) and from different immortalized intestinal and immune cell lines (n=3 ...
-
bioRxiv - Neuroscience 2021Quote: Plasmids encoding GST-BVR (GST-BVRα) and GST-BVRβ were generated by cloning cDNA of human BLVRA and BLVRB into pCMV-GST vector (Clontech/TaKaRa). The construct encoding myc-FAK was generated as previously described (95) ...
-
bioRxiv - Neuroscience 2021Quote: The desired ORF for Pdlim7 (Gene bank ID: AF345904.1) was amplified by PCR from Human Universal QUICK-Clone™ II (Takara 637260) using primers depicted in Table S2 and inserted into pEGFP-C1 plasmid through Gibson assembly.
-
bioRxiv - Microbiology 2021Quote: ... Phage libraries were constructed using antibody gene fragments amplified from PBMCs of 50 healthy human subjects (Allcells, PB003F and PB003C) and total RNA from PBMCs (TaKaRa, 636592), spleens (TaKaRa ...
-
bioRxiv - Cell Biology 2023Quote: The plasmid pEGFP-N1–VMP1 was obtained by inserting the human VMP1 sequence (NCBI reference sequence: NM_030938.5) into pEGFP-N1 (CLONTECH cat. #6085-1). The plasmid pcDNA4-B–hVMP1–V5/His was obtained by inserting the human VMP1 sequence (NM_030938.5 ...
-
bioRxiv - Molecular Biology 2023Quote: ... and CDS of fluorescent proteins were subcloned into pET-human αSyn51 using the KOD-Plus Mutagenesis kit (TOYOBO) and In-Fusion HD Cloning Kit (Takara Bio) according to the manufacturers’ protocol ...
-
bioRxiv - Cell Biology 2023Quote: ... The coding sequence of EPHX2 was amplified by PCR from liver cDNA (Human Multiple Tissue cDNA panels; Takara Bio, Shiga, Japan) using primers (5’-GTCGACATGACGCTGCGCGCGGCCGTCTTCG-3’ ...
-
bioRxiv - Developmental Biology 2023Quote: ... Quantitative RT-PCR for pluripotency and trilineage spontaneous differentiation was performed according to the instruction manual of the human ES cell Primer Array (Takara Clontech).
-
bioRxiv - Biochemistry 2023Quote: Mouse UCP1 gene and human codon-optimized mitoLbNOX and LbNOX (addgene #74448 and #75285) were cloned into pLVX-TRE3G vector (Clontech, CA) using Gibson assembly ...
-
bioRxiv - Cell Biology 2021Quote: ... The cyclin D1-GFP plasmids were constructed by combining the PCR fragment of cyclin D1 from the cyclin D1-Flag plasmid and GFP from pEGFP-N1 (BD Biosciences Clontech) into XPack CMV constructs (System Biosciences) ...
-
bioRxiv - Cell Biology 2020Quote: ... TTAGCTAGCCTTCTGATGTGATAGTTTATC TTCTG-3’ were used to amplify the 3xFLAG-BBS10 from the BBS10 ORF plasmid using CloneAmp HiFi PCR premix (Takara), which was further cloned into the CD520A-GFP plasmid via XbaI and Nhe I restriction sites ...
-
bioRxiv - Genetics 2020Quote: ... Full length wild type NHR-25 was tagged with EGFP at its N-terminus using pEGFP-C2 plasmid vector (Clontech); wild-type and mutant LIR-2s were N-terminally FLAG-tagged using the p3xFLAG-CMV-10 expression vector (SIGMA-Aldrich) ...
-
bioRxiv - Developmental Biology 2021Quote: DN-Brn2 expression vector was generated by PCR amplification of Brn2 DBD and addition of NES sequences using primers ATC ATC GAA TTC GAG AGT CAT GCT TCA ACT TCC TCC TCT TGA ACG CCT TAC CCT TGG AGG AGG AGG ACC GGG CCA CCC AGG CGC GCA C and GAT GAT GGA TCC CCA AGG GTA AGG CGT TCA AGA GGA GGA AGT TGA AGT CCT CCT CCT CCA CCC CCA TAC ACA TCC TCG GC and mBrn2 template plasmid (Sugitani et al. 2002) into mCherry N1 (Clontech). Subsequently ...
-
bioRxiv - Microbiology 2022Quote: ... non-structural genes were PCR amplified in three fragments from the pRepDVRluc plasmid [37] and all fragments were inserted into the PUb-MCS-2A-Puro plasmid [64] using In-Fusion cloning kit (Takara) to generate the PUb-NS(Ø ...
-
bioRxiv - Neuroscience 2021Quote: ... as described previously (Keith et al., 2012, Freund et al., 2016) with plasmids encoding green fluorescent protein (GFP) (pEGFPN1; Clontech), mouse Kif11 (Myers and Baas ...
-
bioRxiv - Genomics 2020Quote: ... The resulting plasmids were digested with Kpn1 and Xho1 at the multiple cloning site of the vector and serially deleted from the XhoI cutting site (5’-protruding end) by treating the plasmids with exonuclease III and mung bean nuclease (Takara) for fixed times ...
-
bioRxiv - Cancer Biology 2019Quote: ... All the amplicons were cloned into a lentiviral plasmid pCSII–CMV–MCS (RIKEN, RDB04377) by using the In-Fusion HD Cloning Kit (TaKaRa), to produce the pCSII– CMV:A3B–3×FLAG–IRES–EGFP donor DNA plasmid.
-
bioRxiv - Developmental Biology 2019Quote: ... The human HSF2-YFP was constructed by PCR and cloned into the XhoI and SalI sites in frame with the N-terminal YFP tag in EGFp-C1 plasmid using In-Fusion Kit (Clontech). All PCR-amplified products for both plasmids were sequenced to exclude the possibility of second site mutagenesis ...
-
bioRxiv - Developmental Biology 2019Quote: ... plasmid after digestion of the inserts by EcoRI and KpnI and cloning into the EcoRI and EcoRV sites in frame with the C-terminal Flag tag in pSNAPf plasmid using In-Fusion Kit (Clontech). The human HSF2-YFP was constructed by PCR and cloned into the XhoI and SalI sites in frame with the N-terminal YFP tag in EGFp-C1 plasmid using In-Fusion Kit (Clontech) ...
-
bioRxiv - Molecular Biology 2019Quote: ... Fusion PCR was carried out to create an eYFP marker under the control of the 3xP3 promoter with an SV40 terminator from plasmids eYFP-mem (Clontech), pBac[3×P3-dsRed]CP-Gal4-GFY-SV40 (Lynd and Lycett 2012 ...
-
bioRxiv - Molecular Biology 2019Quote: ... interaction test and plasmid isolation were performed using the Yeast Protocols Handbook and Matchmaker GAL4TM Two-hybrid System 3 & Libraries User Manual (Clontech).
-
bioRxiv - Genetics 2019Quote: ... guide sequence and modified guide scaffold14 with the design enabling two guide cassettes to be inserted into one plasmid by In-Fusion cloning (Takara). Guide sequences were designed using the CRISPOR tool15 and chosen to flank the microdeletion observed in patient PFS ...
-
bioRxiv - Developmental Biology 2020Quote: ... 5′UTR of test genes and EGFP were inserted into pCAG-FLAG-N1 plasmid 48 using In-Fusion HD Cloning Kit (TAKARA).
-
bioRxiv - Developmental Biology 2021Quote: All novel plasmids constructed for this study were based on the pSP Sox1/2/3> plasmid previously described (9) with the open reading frames replaced by PCR amplifications using a proofreading DNA polymerase (Primestar, Takara) and plasmids were assembled from linear PCR products using NEBuilder HiFi DNA Assembly Master Mix (New England Biolabs) ...
-
bioRxiv - Microbiology 2021Quote: ... CPER fragments containing WT or mutated or 3’UTRs were amplified from the plasmids using PrimeStar GXL polymerase (Takara, Japan) and gel-purified ...