Labshake search
Citations for Takara Bio :
751 - 800 of 1209 citations for Human MMP24 shRNA Plasmid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... The cassette was PCR-amplified from these plasmids utilizing TaKaRa Ex Taq™ DNA Polymerase (Clontech Takara Bio) and used for A ...
-
bioRxiv - Microbiology 2021Quote: ... The cassette was PCR-amplified from these plasmids utilizing TaKaRa Ex Taq™ DNA Polymerase (Clontech Takara Bio) and used for A ...
-
bioRxiv - Molecular Biology 2021Quote: ... 1 μg each CAS9 guide RNA plasmid (pAS4883 and 4884) and 200 ng linear hygromycin resistance gene (Clontech) were used ...
-
bioRxiv - Plant Biology 2021Quote: ... Bait and prey plasmids were co-transformed into the yeast strain AH109 according to the manufacture’s introduction (Clontech). Transformants were selected on SD (-Leu/-Trp ...
-
bioRxiv - Cell Biology 2020Quote: ... HEK293 cells were transfected with pX330 vector together with an EGFP-containing plasmid (pEGFP-N1; Clontech Laboratories, Inc). Single cells were sorted using a FACS Vantage SE machine and the knockouts confirmed by sequencing ...
-
bioRxiv - Neuroscience 2022Quote: ... cells were plated in 24-well plates and transfected with 1.5 μg/μl of psDsRed-2Mito plasmid (Clontech).
-
bioRxiv - Microbiology 2022Quote: All plasmid inserts were amplified by PCR using standard PCR conditions and the CloneAmp HiFi PCR premix (Takara). Following a PCR purification step (QIAquick PCR purification kit) ...
-
bioRxiv - Microbiology 2022Quote: ... CoV-229E sequences were obtained as gBlocks from IDT and subcloned into these plasmids using InFusion cloning (Takara).
-
bioRxiv - Plant Biology 2021Quote: Plasmids for Citrine or mNeon-Green endogenous tagging were assembled using In-Fusion (Clontech, Mountain View, CA, USA), in which Citrine or mNeonGreen genes ...
-
bioRxiv - Developmental Biology 2022Quote: ... PCR-amplified DNA fragments were assembled and cloned into pET-in situ Ble plasmid by recombination (InFusion, Clontech) and the resulting cell line was named ABbin situ ...
-
bioRxiv - Genomics 2022Quote: ... 20 individual bacterial colonies were separately picked from a dilution plating and miniprepped using Nucleospin Plasmid (Takara Bio), and the extracted plasmids were Sanger sequenced to verify the cloning quality of the library ...
-
bioRxiv - Biochemistry 2020Quote: ... To generate stable HaCaT cell lines inducibly expressing V5-Orai1 and Stim1-BirA we used pLVX plasmids (Takara) that were subcloned to express zeocin and blasticidin resistance genes ...
-
bioRxiv - Biochemistry 2019Quote: ... GST and AOC3/ZAG) was amplified by PCR and cloned into the expression plasmid pLVX-Tight Puro (Clontech), which allows packaging of constructs in a lentiviral format ...
-
bioRxiv - Molecular Biology 2020Quote: ... we inserted the coding sequence between the SalI and BamHI restriction sites of the pAcGFP1-N1 plasmid (Takara). The total RNA was extracted from R ...
-
bioRxiv - Synthetic Biology 2020Quote: ... Plasmid constructions were performed with standard restriction enzyme cloning or In-fusion HD Cloning kit (Takara Bio USA) according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2021Quote: ... the cDNA sequence of ERK5 isoforms were cloned into pLVX-Puro plasmid (Clontech Laboratories, Mountain View, CA, USA). Plasmids were sequenced to confirm the presence of correct cDNA sequences at the 3’-end of the CMV promoter (data not shown) ...
-
bioRxiv - Cell Biology 2019Quote: GFP-OPTN pEGFPC2 has been described previously [54] and was subcloned into the pLXIN retroviral packaging plasmid (Clontech) for stable cell line production ...
-
bioRxiv - Molecular Biology 2021Quote: ... a plasmid expressing mCherry under the CMV promoter (pmCherry) was cloned by removing EGFP from pEGFP-C1 (Clontech) with AgeI and BglII and assembling the vector with a synthesized mCherry gene fragment (IDT ...
-
bioRxiv - Biochemistry 2020Quote: Plasmids harboring genes encoding individual PKS modules were either generated in this study via In-Fusion Cloning (Takara), site directed mutagenesis ...
-
bioRxiv - Microbiology 2021Quote: ... the cells were transfected with eukaryotic expression plasmid harbouring FLAG or MYC-tagged FBXO22 using Xfect (TAKARA Bio) transfection reagent according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: CFP/YFP plasmids were constructed by cloning the fluorescent protein coding sequence into pSTV28 (Takara Bio Europe SAS) with EcoRI/SalI restriction sites ...
-
bioRxiv - Microbiology 2020Quote: ... 293T cells were co-transfected with the lentiviral vector plasmid and Lentiviral High Titer Packaging Mix (Takara Bio). The culture supernatants containing lentiviral vectors were used to inoculate target cells ...
-
bioRxiv - Neuroscience 2022Quote: ... This sequence was cloned into the EcoRI-NotI sites of the CRISPRa plasmid using In-Fusion cloning (Takara). All guide sequences and their genomic locations are listed in Supplementary Table S1 and PCR primers used to verify editing are listed in Supplementary Table S2.
-
bioRxiv - Microbiology 2022Quote: ... The coding sequence of enhanced green fluorescent protein (eGFP) was amplified from plasmid eGFP-C1 (6084-1, Clontech) using primers eGFPN-F/eGFPN-R ...
-
bioRxiv - Molecular Biology 2023Quote: ... MaV108 was transformed with a DNA fragment that was amplified by PCR reaction using a plasmid pLexA (Clontech) as a template for HIS3 marker ...
-
bioRxiv - Microbiology 2023Quote: The pEGFP-C1 plasmids including AFF4 3’UTR sites “1-2-3” were generated using pEGFP-C1 (Clontech). The following complementary oligonucleotides were annealed in respective pairs as above (1.25 µM each in 75 mM NaCl ...
-
bioRxiv - Developmental Biology 2023Quote: ... 18-20 μg of indicated plasmids were transfected in HEK293T cells using the CalPhos Mammalian Transfection Kit (Takara). After 48h ...
-
bioRxiv - Molecular Biology 2023Quote: HEK293T/17 cells were co-transfected with 0.8 pmol SINEUP-GFP or miniSINEUP-GFP FRAM (0.8 pmol) and 0.2 pmol sense pEGFP-C2 plasmids (Clontech) in each well of a 6-well culture plate ...
-
bioRxiv - Cell Biology 2023Quote: ... The DCC-GFP D1290N mutant plasmid was generated by point mutation (GAC to AAC oligo CCAACACTCTCAGTGAACCGAGGTTTCGGAG; Infusion, Clontech).
-
bioRxiv - Bioengineering 2023Quote: ... Purified insert DNA was cloned into the linearized modRNAc1 plasmid using the In-Fusion Cloning Kit (Takara Bio). The DNA template for modRNA synthesis was PCR amplified from the successfully cloned modRNAc1 plasmid followed by PCR purification using DNA Clean & Concentrator-5 (Zymo Research) ...
-
bioRxiv - Genetics 2023Quote: ... the miR-34c locus was ligated into the multiple cloning site (MCS) of the pTetOne plasmid (Takara Bio).
-
bioRxiv - Molecular Biology 2024Quote: ... YCplac22 plasmids that carry the cac1-20 mutant allele were constructed using the PrimeSTAR Mutagenesis Basal Kit (TaKaRa) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2024Quote: ... They were transfected with pAAV, pAAV2/1 (Penn Vector Core, Philadelphia, PA, USA) and pHelper plasmids (Takara Bio)52 ...
-
bioRxiv - Neuroscience 2024Quote: ... The pmEOS2-C1-ERGIC53 plasmid was constructed using using the In-Fusion® Snap Assembly Cloning Kit (Takara) and transformed into OmniMAX competent cells ...
-
bioRxiv - Cell Biology 2020Quote: ... at the C-terminus were amplified by PCR using KOD-Plus-Neo polymerase (Toyobo) and Human Universal QUICK-Clone cDNA II (Clontech) for a template cDNA and then cloned into a pET-41 Ek/LIC vector (Novagen) ...
-
bioRxiv - Developmental Biology 2021Quote: ... The guide RNA was designed to target an immediate downstream of the stop codon of the human GATA3 gene and generated using the Guide-it sgRNA In Vitro Transcription System (Clontech). The target sequences of gRNAs are shown in Table S2 ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... mtDNA copy number was determined by quantitative PCR with Human mitochondrial to nuclear DNA ratio kit (Takara Bio USA, 7246).
-
bioRxiv - Molecular Biology 2021Quote: ... cDNA fragment of human METTL18 with a C-terminal HA sequence was cloned into AgeI and EcoRI sites of the pQCXIP vector (Clontech). To generate hMETTL18-Asp193Lys-Gly195Arg-Gly197Arg-HA ...
-
bioRxiv - Immunology 2020Quote: ... Transient retroviral supernatants were produced as previously described.44 Activated NK cells were purified and transduced with retroviral supernatants on day +4 in human fibronectin-coated plates (Clontech Laboratories ...
-
bioRxiv - Biochemistry 2019Quote: ... 5’UTRs of MAGED2 TV2 and TV3 were amplified by RT-PCR from RNA isolated from human testes tissue purchased from Takara Bio (Mountain View ...
-
bioRxiv - Plant Biology 2020Quote: ... Plasmids for the PARN activity assay were constructed by inserting the coding sequence of RRD1 or human PARN (hPARN) into the pHAT vector (Clontech). The hPARN sequence was derived from the GNP Human cDNA clone IRAK071M01 (RIKEN BioResource Research Center) ...
-
bioRxiv - Cell Biology 2020Quote: ... 3C protease-cleavage site and a His12-tag at the N-terminus were amplified by PCR using KOD-Plus-Neo polymerase (Toyobo) and Human Universal QUICK-Clone cDNA II (Clontech) as a template cDNA and then cloned into a pET-41 Ek/LIC vector (Novagen) ...
-
bioRxiv - Neuroscience 2020Quote: We transiently co-transfected cDNA constructs of GluN1 and GluN2A into mammalian human embryonic kidney 293 (HEK293) with a separate pEGFP-Cl vector (Clontech) at a ratio of 4.5:4.5:1 (GluN1/GluN2A/EGFP ...
-
bioRxiv - Microbiology 2022Quote: Sequence of the human variable heavy and kappa chains were obtained by using SMARTer 5’ RACE technology (Takara Bio USA) adapted for antibodies to amplify the variable genes from heavy and kappa chains for each hybridoma ...
-
bioRxiv - Cell Biology 2022Quote: pLVX-Puro GFP-TMEM11 was generated by PCR amplifying TMEM11 from human cDNA and cloning into the XhoI/BamHI sites of pAcGFP1-C1 (Takara), followed by subsequent cloning of the GFP-TMEM11 cassette into the Xho/BamHI sites of pLVX-Puro (Takara ...
-
bioRxiv - Neuroscience 2021Quote: ... The cDNAs encoding full-length human HCN1 channel and mouse TRIP8b (splicing variant 1a-4) were cloned into the pcDNA 3.1 (Clontech Laboratories) mammalian expression vector ...
-
bioRxiv - Molecular Biology 2022Quote: ... and Human GABRB3 (IMAGE ID 3871111, Source BioScience) were used to obtain N-terminal GST fusions in pGEX-KG (Clontech) or N-terminal FLAG fusions in pJEN1 (pcDNA3 derived ...
-
bioRxiv - Neuroscience 2022Quote: The Yeast-Two-Hybrid screening for Jacob interaction partners was performed using a pretransformed human brain cDNA Library in pACT2 (Matchmaker-GAL4 Two-Hybrid II; Clontech) as described previously (Helmuth et al. ...
-
bioRxiv - Microbiology 2019Quote: Total RNA of the human multiple myeloma cell line KMM-1 was extracted with RNAiso Plus (Takara Bio, Shiga, Japan). A 24-nt RNA ...
-
bioRxiv - Immunology 2019Quote: ... Rab 5 and Rab 7 cDNA (a gift of M. Sandor) and human CD81 cDNA (Open Biosystems) were cloned into pmCherry-N1 vector (Clontech). Raji/DC-SIGN cells were electroporated with 1 µg of indicated plasmid using the Eppendorf Multiporator in iso-osmolar electroporation buffer using a 90 µs ...