Labshake search
Citations for Takara Bio :
851 - 900 of 2594 citations for 6 9 Methano 4 1 benzoxazepin 2 3H one octahydro 3 methyl 3 α 5a bta 6 bta 9 bta 9a bta 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2023Quote: ... 2 µg pantropic pVSV-G (Clontech), 3 µg pCL- (Imgenex) ...
-
bioRxiv - Immunology 2023Quote: ... 2 µL 100 µM DTT (Takara), 2 µL 10 µM template switching oligo ...
-
bioRxiv - Immunology 2023Quote: ... version 2 (Takara cat. no. 634411) and mRRBS library preparation was performed using custom procedures previously described by our group (23 ...
-
bioRxiv - Molecular Biology 2024Quote: ... and 2 U recombinant inhibitor (TaKaRa) for samples containing biological inhibitor ...
-
bioRxiv - Biochemistry 2021Quote: ... A total of 5 μg of RNA were reverse transcribed and amplified using One Step SYBR Prime-Script PLUS RT-PCR Kit (TaKaRa) and the Thermal Cycler Dice instrument (TaKaRa ...
-
bioRxiv - Molecular Biology 2020Quote: ... One µg of total RNA was used as input for SMARTer Stranded Total RNA Sample Prep Kit-HI Mammalian (Clontech). Sequencing was performed on the NextSeq500 instrument (Illumina ...
-
bioRxiv - Genetics 2021Quote: ... and then RT-qPCR was performed using a One Step SYBR PrimeScript PLUS RT-PCR kit (Takara Bio, Shiga, Japan) and Applied Biosystems ABI Prism 7000 Sequence Detection System ...
-
bioRxiv - Molecular Biology 2021Quote: The Tet-on vector was obtained from the Lenti-X Tet-One Inducible Expression System (Puro) (Clontech, Cat. No. 634847). We transfected 1 × 106 HDR-immortalized cells using the Neon nucleofection system and 10 μg of plasmid DNA (plasmid encoding Cre recombinase ...
-
bioRxiv - Cell Biology 2022Quote: ... LC NLS deletion (Δ417-422) was generated by KOD One PCR amplification and the In-Fusion HD Cloning Kit (Clontech). The NLS of SUN2 (KDSPLRTLKRKSSNMKRL ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... and each RNA concentration was measured by quantitative PCR after reverse transcription using PrimeScript One Step RT-PCR Kit (TaKaRa) with each specific primer (Table S2).
-
bioRxiv - Genetics 2019Quote: ... guide sequence and modified guide scaffold14 with the design enabling two guide cassettes to be inserted into one plasmid by In-Fusion cloning (Takara). Guide sequences were designed using the CRISPOR tool15 and chosen to flank the microdeletion observed in patient PFS ...
-
bioRxiv - Microbiology 2020Quote: ... The viral load was measured by RT-qPCR using One-Step SYBR® Primescript™ RT-PCR kit II (Takara). CT values of serum samples were used to calculate serum viral titre according to regression equation built by RNA extracted from 10 µL of 102-106 pfu/mL of ZIKV (PRVABC59 or MP1751) ...
-
bioRxiv - Cell Biology 2021Quote: ... RT-PCR was performed using the One Step TB Green PrimeScript PLUS RT-PCR Kit (Perfect Real Time; Takara, Japan) and Thermal Cycler Dice® Real Time System Lite (TP700 ...
-
bioRxiv - Cell Biology 2022Quote: ... Lentiviral supernatants were collected 48 h post-transfection and concentrated by adding one volume of Lenti-X Concentrator (Takara Bio) to three volumes of lentivirus-containing supernatant and incubating at 4°C overnight ...
-
bioRxiv - Microbiology 2022Quote: ... Then RNA was reverse-transcribed and amplified using One Step PrimeScriptTM III RT-qPCR Mix kit (Takara Bio, Kyoto, Japan). Primers and probes ...
-
bioRxiv - Plant Biology 2022Quote: ... PtoATPE and PtoPSBB) were co-transformed into the Y1HGold yeast strain using the Matchmaker One-Hybrid Library Construction and Screening Kit (Clontech), respectively ...
-
bioRxiv - Microbiology 2022Quote: ... One μg of total RNA was used as input for SMARTer Stranded Total RNA Sample Prep Kit-HI Mammalian (Clontech). Sequencing was performed on the NextSeq500 instrument (Illumina ...
-
bioRxiv - Immunology 2020Quote: ... Detection of the number of copies of extracted RNA was performed using the Real-Time One-Step RT-PCR reagent (Takara). The following was the reaction system ...
-
bioRxiv - Microbiology 2020Quote: ... according to the manufacturer’s instructions and detected by RT-qPCR assays with a One-Step PrimeScript RT-PCR kit (Takara, Japan) using SARS-CoV-2-specific primers on an Applied Biosystems 7500 Real-time PCR System.
-
bioRxiv - Cell Biology 2021Quote: ... Viral RNA was quantified using a One Step TB Green PrimeScript PLUS RT-PCR Kit (Perfect Real Time) (Takara Bio) on a StepOnePlus real-time PCR system (Thermo Fisher Scientific) ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... The concentrations of the host and the parasitic RNAs were measured by RT-qPCR (PrimeScript One Step RT-PCR Kit (TaKaRa)) with sequence-specific primers (Supplementary text).
-
bioRxiv - Neuroscience 2022Quote: ... 2016) with the design enabling two guide cassettes to be inserted into one SaCas9 plasmid by In-Fusion cloning (Takara). Guide sequences were designed using the online CRISPOR design tool (Haeussler et al ...
-
bioRxiv - Molecular Biology 2022Quote: Y1H library screening was performed by using the Matchmaker Gold Yeast One-Hybrid Library and Screening kit (Clontech,CA, USA). The promoter fragments of CaPR1 were inserted in the pAbAi vectors ...
-
bioRxiv - Microbiology 2023Quote: ... and were quantified by real-time RT-PCR using One Step TB Green PrimeScript RT-PCR Kit II (Perfect Real Time) (TaKaRa) and QuantStudio 3 Real-Time PCR System (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2022Quote: ... One microgram of total RNA was used as a template in reverse transcription reactions using 0.2 mM dNTP (TakaRa Bio), 1 U/μL ribonuclease inhibitor (porcine liver ...
-
bioRxiv - Microbiology 2022Quote: ... was used as the template for real-time RT-PCR performed according to the manufacturer’s protocol using the One Step TB Green PrimeScript PLUS RT-PCR kit (Takara-Bio) and the following primers ...
-
bioRxiv - Immunology 2023Quote: ... covering SIV env and nef were amplified from plasma viral RNA by nested RT-PCR using Prime-Script one-step RT-PCR kit v2 (TaKaRa) and KOD-Plus v2 (Toyobo) ...
-
bioRxiv - Developmental Biology 2023Quote: ... and RT-PCR was performed to detect sorcs2 mRNA in wt embryos using the Titanium One-Step RT-PCR kit (Clontech) with primers 5’-TTTTGCGCACCTGTACCCAGCTG-3’ and 5’-TAACGCGCTCCTGAAGCAGAGTC-3’ for detection of mRNA after injection of different amounts of sMO and 5’-TTTTGCGCACCTGTACCCAGCTGTGTT-3’ and 5’ TAACGCGCTCCTGAAGCAGAGTCCATT-3’ for the different developmental stages ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... The PCR products of the exons were assembled into one full-length sequence using overlapping PCR (In-fusion cloning, Clontech) for each TAS1R and were then subcloned into the pEAK10 expression vector (Edge Biosystems ...
-
bioRxiv - Microbiology 2024Quote: ... The RNA samples were then reverse transcribed employing a One-Step SYBR PrimerScript reverse transcription (RT)-PCR kit (TaKaRa, Japan). Nested PCR conditions were as follows ...
-
bioRxiv - Developmental Biology 2021Quote: ... Sections were blocked in 5% goat serum then incubated with primary antibody at 4°C overnight (anti-dsRed for tdTomato (632496, 1:1000; Takara Bio, Mountain View, CA, USA), anti-SP7 (ab22552 ...
-
bioRxiv - Neuroscience 2020Quote: ... 2 μL of the RT reaction was combined with 2.5 μL of 10X Advantage 2 buffer (Takara), 2.5 μL of 2.5 mM dNTPs (Takara) ...
-
bioRxiv - Cell Biology 2023Quote: ... A total of 1-2 μg RNA was reverse transcribed with random hexamers using PrimeScript 1st strand cDNA synthesis kit (Takara Bio, Japan) per the manufacturer’s protocol on Verti 96 well thermocycler (Thermo Scientific ...
-
bioRxiv - Molecular Biology 2019Quote: ... PCR products were gel purified (Machery Nagel) and used to generate α-32P dCTP-labeled probes using the Random Prime Labeling Kit (Takara/Clontech). Probes were purified over nucleotide purification columns (Zymo Research ...
-
bioRxiv - Immunology 2022Quote: ... TCR α- and β-chain genes were reverse transcribed and amplified from the RNA using the SMARTer RACE Kit (Clontech Laboratories, Inc). The amplified TCR genes were sub-cloned into the pEF- 1α/pENTR vector (Addgene ...
-
bioRxiv - Plant Biology 2023Quote: ... and on a SD-Leu-Trp-Ade-His plate containing X-α-gal and supplemented with 0.2 µg/ml Aureobasidin A (Takara Bio, USA). Plates were imaged after incubation for 60–72 hr at 30 °C ...
-
bioRxiv - Molecular Biology 2024Quote: ... forward = TTTCTAAGACTCTCTCCCGTA and reverse = GATTAGAAGTAGCCGACCAA) was labeled with dCTP [α-32P] using Random Primer DNA Labeling Kit Ver.2.0 (Takara, catalog #6045). The hybridization was done at 65°C overnight in Church and Gilbert Moderate Hybridization Buffer (1% BSA ...
-
bioRxiv - Biochemistry 2021Quote: ... then incubated at 4 °C in Lenti-X Concentrator (Clontech) for 1 h ...
-
bioRxiv - Genomics 2023Quote: ... 4 µl of Dr.GenTLE precipitation carrier (Takara, cat. no. 9094) and 4 µl sodium acetate ...
-
bioRxiv - Plant Biology 2020Quote: ... The yeast one-hybrid (Y1H) assay was conducted using the Matchmaker™ Gold Yeast One-Hybrid Library Screening System kit (Cat. no. 630491, Clontech).
-
bioRxiv - Plant Biology 2019Quote: ... One microgram of DNA-free RNA was used to synthesize cDNA by using PrimeScriptTM RT Reagent Kit (TAKARA, Kusatsu, Shiga, Japan).
-
bioRxiv - Plant Biology 2022Quote: ... The recombinant constructs was transformed into Y1H gold strain and Y1H assay was performed using Matchmaker® Gold Yeast One-hybrid screening system (Takara) following the manufacturer’s protocol ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... and each RNA concentration was measured by quantitative PCR after reverse transcription using PrimeScript One Step RT-PCR Kit (TaKaRa, Japan) with specific primers (Table S2) ...
-
bioRxiv - Molecular Biology 2021Quote: ... Gene expression in the cDNA samples was measured by one-step qRT-PCR using a One Step PrimeScript RT-PCR Kit (Perfect Real Time) according to the manufacturer’s specifications (Takara, Dalian, China). Quantitative real-time PCR was performed on the CFX Connect Real-Time PCR Detection System (Bio-Rad ...
-
bioRxiv - Biochemistry 2019Quote: ... the URAT1/SLC22A12 gene promoter region was amplified using KOD One PCR Master Mix (TOYOBO) or PrimeSTAR® Max DNA Polymerase (Takara) with the following primers ...
-
bioRxiv - Microbiology 2022Quote: ... was used as the template for real-time RT-PCR performed according to the manufacturer’s protocol using the One Step TB Green PrimeScript PLUS RT-PCR kit (Takara, Cat# RR096A) and the following primers ...
-
bioRxiv - Microbiology 2022Quote: ... The PCR product was purified and ligated into the pET15b vector with a C-terminal His tag to create plasmid pET-AdpA by using the ClonExpress™ II One Step Cloning Kit (TaKaRa). The plasmid was transformed into E ...
-
bioRxiv - Immunology 2022Quote: ... added with RT-PCR master mix and IgG VH/VL primers per well and performed with RT-PCR following the one step RT-PCR kit protocol (Takara, RR057A). Then ...
-
bioRxiv - Neuroscience 2021Quote: ... Up to a maximum of 50 cells were sorted into one well filled with 9uL of Clontech lysis buffer (Single-cell lysis buffer 10x, #635013 Takara Bio) + 5% RNAse inhibitor (40U/ul ...
-
bioRxiv - Microbiology 2021Quote: ... The supernatant or RNA were directly used for one-step RT-qPCR using PrimeDirect™ Probe RT-qPCR Mix (TaKaRa, Japan) according to manufacturer’s instructions ...