Labshake search
Citations for Takara Bio :
751 - 800 of 2075 citations for Monoisononyl Phthalate 100 Ug Ml In Mtbe Ring 1 2 13C2 Dicarboxyl 13C2 99% since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2022Quote: ... PDGF-aa (20 ng/ml; R&D) is also supplemented to RHB-A (Takara). This medium composition will be referred to as RHB-A complete ...
-
bioRxiv - Developmental Biology 2021Quote: ... 0.3 μM gene-specific forward/reverse primers and 2 μL of diluted cDNA using a thermal cycler Dice (Takara). The reactions were carried out as follows ...
-
bioRxiv - Molecular Biology 2021Quote: ... Methylated and non-methylated DNA fragments were separated using the EpiXplore Methylated DNA Enrichment Kit (Clontech, cat# PT5034-2). Libraries were generated using the DNA SMART ChIP-Seq Kit (Takara ...
-
bioRxiv - Plant Biology 2020Quote: ... Approximately 2 μg of total RNA was reverse-transcribed using PrimeScript™ RT reagent Kit with gDNA Eraser (TaKaRa). Real-time quantitative RT-PCR was performed with TB Green Premix Ex Taq™ (TakaRa ...
-
bioRxiv - Microbiology 2021Quote: ... CPER mixtures contained 0.1 pmol of each DNA fragment and 2 µl of PrimeStar GXL DNA polymerase (Takara, Japan) in a total reaction volume of 50 µl ...
-
bioRxiv - Cell Biology 2022Quote: ... The yeast was transformed with the indicated plasmids using the Matchmaker™ Yeast Transformation System 2 (Clontech, Cat#: 630439). Two plasmids containing simian virus (SV ...
-
bioRxiv - Microbiology 2022Quote: The plasmids of the SARS-CoV-2 cDNA library as cloned in the pLVX-EF1alpha-IRES-Puro (Takara/Clontech) vector were a kind gift from Prof ...
-
bioRxiv - Microbiology 2022Quote: The plasmids of the SARS-CoV-2 cDNA library as cloned in the pLVX-EF1alpha-IRES-Puro (Takara/Clontech) vector were a kind gift from Prof ...
-
bioRxiv - Cell Biology 2021Quote: ... HUVECs were maintained in Endothelial Cell Basal Medium 2 supplemented with Endothelial Cell Growth Medium kits (C22211, C22111, Takara). For replating cells ...
-
bioRxiv - Immunology 2020Quote: ... and a primer (1μM final concentration) binding to the introduced SMARTER oligonucleotide (CTAATACGACTCACTATAGGGC) using the Advantage 2 PCR kit (Clontech) in a 50μl reaction ...
-
bioRxiv - Biochemistry 2022Quote: ... and ligated into the multiple cloning site 2 (MCS2) of the pTRE3G-BI vector (Clontech, Mountain View, CA, USA), resulting in the construct pTRE3G-BI/GPR83-LgBiT ...
-
bioRxiv - Bioengineering 2022Quote: ... RNA (2 µg) was reverse transcribed into cDNA with the RT Reagent Kit with gDNA Eraser (Takara, Japan, RR047A). qPCR was performed using a SYBR Premix Ex Taq kit (Takara ...
-
bioRxiv - Microbiology 2023Quote: ... or Omicron variant (G339D) using a SARS- CoV-2 Direct Detection RT-qPCR Kit (TaKaRa Bio Inc., Shiga, Japan) with each specific primer/probe ...
-
bioRxiv - Molecular Biology 2022Quote: ... one subjected to RT-PCR using PrimeScript™ One Step RT-PCR Kit Ver.2 (Dye Plus) (Takara, Japan), then the region between S-5’UTR and N protein-ORF genes was amplified to monitor the expression of eGFP.
-
bioRxiv - Plant Biology 2023Quote: ... Yeast transformation was performed as described in the Yeastmaker Yeast Transformation System 2 User Manual (Clontech, TaKaRa Bio, USA). Serial dilution of transformed colonies were dropped on –Trp/-His synthetic dropout selection medium ...
-
bioRxiv - Plant Biology 2023Quote: ... Yeast transformation was performed as described in the Yeastmaker Yeast Transformation System 2 User Manual (Clontech, TaKaRa Bio, USA). Serial dilution of transformed colonies were dropped on –Trp/-His synthetic dropout selection medium ...
-
bioRxiv - Genetics 2023Quote: ... The transformation process followed the protocol described in the Yeastmaker™ Yeast Transformation System 2 User Manual (Takara Bio), yielding approximately 2 × 106 and 7 × 106 transformants for LE9 and BLX strains ...
-
bioRxiv - Molecular Biology 2023Quote: ... and then used as the template to synthesize double strand cDNA amplicons by PCR (optimal 17 – 21 cycles) using Advantage 2 PCR kit according to the manufacturer’s specifications (Clontech). cDNA was purified using NucleoSpin Gel and PCR Clean-up kit (Takara Bio) ...
-
bioRxiv - Biochemistry 2023Quote: ... The membrane was incubated for 1 h at room temperature with Odyssey blocking buffer and 0.2 % PBS-T (PBS containing 0.2 % (v/v) Tween-20) with rat anti-HA clone 3F primary antibody (Clontech) at 1:1,000 dilution ...
-
bioRxiv - Plant Biology 2023Quote: ... Approximately 2.6 x 106 yeast transformants were screened on 2% SD/Gal/Raf/X-P-gal (-Ura/-His/-Trp/-Leu) following the manufacturer’s instructions (Clontech). Direct protein-protein interaction was confirmed by co-transformation of the respective plasmids into the yeast strain AH109 using the Matchmaker GAL4 Two-hybrid System (Clontech) ...
-
bioRxiv - Molecular Biology 2024Quote: ... cDNA encoding FLAG-Rhino was cloned into pPB-2× Ty1-Tjen-EGFP-P2A-BlastR51 using In-Fusion cloning (TAKARA), bearing pPB-FLAG-Rhino-Tjen-EGFP-P2A-BlastR ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... All yeast 2-hybrid screens were done using the Matchmaker® Gold Yeast Two-Hybrid System (Takara Bio USA) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2024Quote: ... Supernatant containing viral particles was harvested after 2 and 3 days and concentrated 100x using Lenti-X concentrator (Takara) following manufacturers instructions.
-
bioRxiv - Neuroscience 2019Quote: ... anti-tdTomato (1:500, Clontech), anti-MAP2 (1:500 ...
-
bioRxiv - Cell Biology 2019Quote: ... EGFP-N1 (Clontech #6085-1); GFP-ERcyt ...
-
bioRxiv - Cancer Biology 2019Quote: ... 1 unit/μl reaction (Clontech). After incubation with PI (1:1000 ...
-
bioRxiv - Neuroscience 2020Quote: ... pN1-EGFP (Clontech, 6085-1) was used for cell visualisation.
-
bioRxiv - Neuroscience 2020Quote: ... pN1-EGFP (Clontech, 6085-1) was used for cell visualisation.
-
bioRxiv - Neuroscience 2021Quote: ... and mCherry (1:200, Takara Bio USA Inc./Clontech Laboratories ...
-
bioRxiv - Cell Biology 2021Quote: ... α-dsRed (1:300, Takara, 632392), α-γ-tubulin (1:300 ...
-
bioRxiv - Microbiology 2021Quote: ... 1× ExTaq PCR buffer (Takara, Clontech Laboratories ...
-
bioRxiv - Cell Biology 2022Quote: ... anti-DsRed (TaKaRa, 1:200), anti-F-actin (Abcam ...
-
bioRxiv - Cell Biology 2022Quote: ... anti-DsRed (TaKaRa, 1:10000), anti-actin (Abcam ...
-
bioRxiv - Neuroscience 2019Quote: ... pEGFP-N1 (Clontech, 6085-1). Antibodies include ...
-
bioRxiv - Genomics 2021Quote: ... 1 mM dNTPs (Clontech, #639125), 1 U/μL Rnase Inhibitor (Lucigen ...
-
bioRxiv - Genomics 2021Quote: ... 1×GC buffer ? (Takara, 9155) for 30 PCR cycles ...
-
bioRxiv - Physiology 2022Quote: ... and mCherry (1:500, Takara). Alexa Fluor-conjugated secondary antibodies were used at 1:500 (Millipore) ...
-
bioRxiv - Neuroscience 2022Quote: ... anti-DsRed (1:500, Clontech), anti-Synapsin I (1:1000 ...
-
bioRxiv - Immunology 2023Quote: ... resuspended in CELLBANKER 1 (Takara), and stored at -80°C ...
-
bioRxiv - Neuroscience 2023Quote: ... FOXG1 (rabbit, 1:200, Takara), FOXP2 (goat ...
-
bioRxiv - Physiology 2023Quote: The WST-1 assay (Takara) was performed on HepG2 cells and Huh7 cells to assess the cellular cytotoxicity of Tecomella undulata ...
-
bioRxiv - Bioengineering 2023Quote: ... Stem121 (Takara Y40410; 1:1000), and Stem123 (Takara Y40420 ...
-
bioRxiv - Physiology 2024Quote: ... and mCherry (1:500, Takara). Secondary antibodies from Invitrogen (Alexa Fluor 647 goat anti-rabbit ...
-
bioRxiv - Microbiology 2022Quote: ... The resulting probe reaction mixtures were electrophoresed on a 0.8% agarose gel for 30 min at 100 V and then gel purified with a NucleoSpin Gel and PCR Clean-up kit (Takara Bio USA). The EMSA binding reaction ...
-
bioRxiv - Physiology 2023Quote: ... cDNA was made from 100-400 ng of DNase-treated total RNA using a Takara PrimeScript RT Reagent Kit with gDNA Eraser (Takara bio RR047B). Quantitative PCR was performed using TB Green™ Premix Ex Taq™ (Tli RNaseH Plus ...
-
bioRxiv - Plant Biology 2023Quote: ... an aliquot (100 µL) of transformed cells was then plated onto SD media containing the appropriate dropout supplement (Takara Bio USA, Inc.), and grown at 30°C for up to 7 days.
-
bioRxiv - Microbiology 2023Quote: ... The protocol was as follows: PCR reaction mixture (100 nL) was prepared using SmartChip TB Green Gene Expression Master Mix (TaKara Bio, Japan), nuclease-free PCR-grade water ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... Spec.100) and TB Green TM Premix Ex TaqTM II (Tli RNaseH Plus) (RR820A, Spec. 200) were supplied by Takara (Beijing, China). IP cell lysate (P0013 ...
-
bioRxiv - Systems Biology 2023Quote: ... cDNA libraries for each sample were constructed from 100 ng of RNA using the PrimeScript RT master mix (Takara Bio, Kutatsu, Japan) under manufacturer specifications ...
-
bioRxiv - Cell Biology 2020Quote: ... mouse anti-GFP (for immunohistochemistry 1:1000, Molecular Probes; for Western blotting: 1:10000, Clontech), mouse anti-Tubulin (1:80 ...