Labshake search
Citations for Takara Bio :
601 - 650 of 2075 citations for Monoisononyl Phthalate 100 Ug Ml In Mtbe Ring 1 2 13C2 Dicarboxyl 13C2 99% since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2022Quote: ... Yeast transformation was performed according to the Yeastmaker Yeast Transformation System 2 User Manual (Clontech, Japan). The primers used are listed in Supplemental Table S1.
-
bioRxiv - Immunology 2022Quote: ... SARS-CoV-2 RBDs were purified using a Cobalt affinity column (HisTALON Superflow column from Takara or HiTrap TALON crude column from Cytiva ...
-
bioRxiv - Neuroscience 2023Quote: ... 5 μl of the PCR product was treated with 2 μl cloning enhancer (Takara-bio Inc.). The cloning reaction was prepared by adding 2 μl of 5X In-Fusion HD Cloning enzyme mix ...
-
bioRxiv - Immunology 2022Quote: ... and treated with Exonuclease I (New EnglandBiolabs) before amplification by the Advantage 2 PCR kit (Clontech) and the SINGV6 primer (95°C for 1 min ...
-
bioRxiv - Developmental Biology 2023Quote: Yeast two-hybrid assays were performed according to the Yeastmaker Yeast Transformation System 2 manual (Clontech). The yeast strain AH109 was co- transformed with an AD-fused and a BD-fused construct using the lithium acetate method ...
-
bioRxiv - Cancer Biology 2023Quote: ... 2 μg of RNA was converted to cDNA using PrimeScript 1st Strand cDNA Synthesis Kit (TaKaRa) in SureCycler 8800 (Agilent Technologies) ...
-
bioRxiv - Cell Biology 2023Quote: ... Second strand synthesis and PCR amplification was performed by adding the Advantage 2 Polymerase Mix (Clontech) and the SINGV6 primer (10 pmol ...
-
bioRxiv - Microbiology 2024Quote: ... UMI-tagged spike gene cDNA was amplified using the Advantage 2 PCR kit (Takara Bio, 639206) with forward primer TTCGCATGGTGGACAGCCTTTGTT and reverse primer CCGCTCCGTCCGACGACTCACTATA under the following thermocycling conditions ...
-
bioRxiv - Cancer Biology 2024Quote: ... 2 μg of genomic DNA was used as a template using Titanium Taq PCR kit (Takara). The sequence information for the primers used for barcode amplification was kindly provided by Novartis and can be found in Supplementary Table 4 ...
-
bioRxiv - Molecular Biology 2021Quote: ... and 1 µM of Shield-1 peptide (Clontech, Mountain View CA) for 4-6 hours ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 1 μM of Shield-1 peptide (Clontech, Mountain View CA) for 4 h ...
-
bioRxiv - Molecular Biology 2024Quote: - IgG detector solution V2 (1:2000 dilution, Takara, Cat# T7122A-1).
-
bioRxiv - Molecular Biology 2024Quote: IgG detector solution V2 (1:2000 dilution, Takara, Cat# T7122A-1).
-
bioRxiv - Plant Biology 2020Quote: ... cDNA was diluted to 100 ng/μl and was mixed with Green Premix Ex Taq II (Takara Bio, China) and amplifications were carried out following the manufacturer’s protocol ...
-
bioRxiv - Immunology 2021Quote: ... 48hrs later the virus-containing supernatant from HEK-293T cells was concentrated 100-fold using Lenti-X concentrator (Takara). Titration was performed on HEK293T cells (ATCC ...
-
bioRxiv - Neuroscience 2022Quote: ... coli cells induced with 100 mM IPTG and purified from bacterial extracts using TALON beads (Takara Bio, Catalog # 635502) according to the vendor’s instructions.
-
bioRxiv - Microbiology 2020Quote: ... The supernatant was filtered through a 0.45μm PES filter and the viral particles concentrated 100 times using Lenti-X™ Concentrator (Takara) before storage at −80 ...
-
bioRxiv - Molecular Biology 2022Quote: ... the cell pellets were resuspended in the prepared cell lysis buffer (0.1% Triton-X, 20 mM Tris, 100 mM NaCl) and ProteoGuard EDTA-Free protease inhibitor cocktail (Takara) for 30 minutes followed by sonication in ice cold water for 40 minutes (75 amplitude ...
-
bioRxiv - Biochemistry 2021Quote: ... After incubation for 2 hours at 4°C the resin was washed extensively with buffer B and the flWT-Kv3.1 tetramer was eluted by addition of 100 µl of HRV 3C Protease at 1U/µl concentration from Takara Bio ...
-
bioRxiv - Microbiology 2023Quote: ... and an aliquot of 100 ng was reverse transcribed with the PrimeScript RT Reagent Kit with gDNA Eraser (Takara) and the included primer mix ...
-
bioRxiv - Neuroscience 2023Quote: ... A total of 100 microglia from each region were collected in 5 μL single-cell lysis buffer (635013, Takara), and flash-frozen on dry ice.
-
bioRxiv - Molecular Biology 2023Quote: ... 100 ng of each RNA sample was reverse-transcribed with PrimeScript RT Master Mix (Perfect Real Time) (Takara Bio). qPCR was performed using the QuantiTect SYBR Green PCR Kit (QIAGEN) ...
-
bioRxiv - Microbiology 2020Quote: ... The membrane was then pre-hybridized in 10 mL ExpressHyb (Clontech, NC9747391) at 44°C in a rotating oven for 1 hour ...
-
bioRxiv - Molecular Biology 2021Quote: ... 50 ng/ml of doxycycline (Takara Bio USA, Mountain View, CA, USA) were added to each cell lines and cultured for 48 h.
-
bioRxiv - Biochemistry 2021Quote: ... The resin was then loaded on a reusable column (20 ml, Clontech) and washed with 20 ml of binding buffer ...
-
bioRxiv - Cancer Biology 2020Quote: ... NLRP3 expression was induced by adding 0.5 μg/mL doxycycline (Takara Bio) to the cell culture medium.
-
bioRxiv - Biochemistry 2021Quote: ... clarified supernatants were purified using a 5 ml Cobalt affinity column (Takara). HCoV-OC43 S was purified using a StrepTrap HP column (GE healthcare) ...
-
bioRxiv - Neuroscience 2020Quote: ... and the supernatant was mixed with Ni-NTA resin (Clontech, 3 mL) and kept on a rocker at RT for 30 min ...
-
bioRxiv - Biochemistry 2019Quote: ... the supernatant was rotated with 1.5 mL of TALON Cobalt resin (Clontech) for 30 min at 4°C in the presence of 5 mM imidazole ...
-
bioRxiv - Biochemistry 2019Quote: ... The supernatant was rotated with 0.5 mL of TALON Cobalt resin (Clontech) for 30 min at 4°C in the presence of 5 mM imidazole ...
-
bioRxiv - Immunology 2020Quote: ... pre-coated with retronectin (50 μg/mL, Takara Bio. Inc., Shiga, Japan). Activated T cells were spinoculated at 32 °C at 750 g for 60 minutes ...
-
bioRxiv - Molecular Biology 2023Quote: ... Cleared lysates were applied to 3 mL TALON Metal Affinity Resin (Takara) and incubated for 30 minutes at 4 °C ...
-
bioRxiv - Developmental Biology 2023Quote: ... and TetON-regulated transgenes were activated by 2µg/ml doxycyclin (Clontech #63131l) medium supplementation at DIV4.
-
bioRxiv - Biochemistry 2022Quote: ... The supernatant was applied on a Talon affinity column (10 ml; Clontech) equilibrated in buffer A ...
-
bioRxiv - Synthetic Biology 2023Quote: ... polystyrene plates were coated overnight with 20 µg/mL retronectin (Takara Bio.) in PBS at 4°C ...
-
bioRxiv - Neuroscience 2023Quote: ... supplemented with 6 ml Lenti-X Concentrator (Takara Bio; Cat. No. 631231), mixed thoroughly ...
-
bioRxiv - Bioengineering 2023Quote: ... digested in 50 mg/mL Yatalase in PBS (Takara Bio, Cat# T017) for 40 minutes at RT and rinsed 3 times with PBS ...
-
bioRxiv - Microbiology 2023Quote: ... The membrane was then pre- hybridized in 10 mL ExpressHyb (Clontech, NC9747391) at 44°C in a rotating oven for 1 hour ...
-
bioRxiv - Immunology 2020Quote: Levels of p24 antigen in the purified SARS-CoV-2 pseudotype solution was measured by ELISA (Takara). Mouse sera were heat inactivated ...
-
bioRxiv - Cell Biology 2021Quote: ... DNA was amplified from WT genomic DNA by PCR using Advantage 2 Polymerase (#639202, Takara Bio, USA). Plasmid backbones were double-digested with the necessary restriction enzymes and purified using the Qiagen DNA purification kit (#28704X4 ...
-
bioRxiv - Physiology 2021Quote: ... 2 µL of the synthesized cDNA was mixed with SYBR Premix Ex Taq II (Takara Bio Inc.) and 0.4 µM primers (same as above ...
-
bioRxiv - Molecular Biology 2022Quote: ... the JAK3 open reading frame was amplified by PCR using the Advantage 2 polymerase mix (Takara Bio) with JAK3-ORF primers (Table 1 ...
-
bioRxiv - Microbiology 2022Quote: ... Make Your Own “Mate & Plate™” Library System and Yeast Transformation System 2 were purchased from TaKaRa. Synthetic-defined (SD ...
-
bioRxiv - Immunology 2021Quote: ... Synthesis of cDNA was performed by using 2 μg of total RNA with PrimeScriptTM Reverse Transcriptase (Takara) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... The sequence encoding amino acids 2-1273 were cloned into a shuttle plasmid following InFusion cloning (Clontech). The shuttle plasmid encodes a modified human cytomegalovirus major immediate early promoter (IE CMV ...
-
bioRxiv - Genomics 2019Quote: ... in a 20-μL reaction volume with 10 μL of 2× SYBR Premix Ex Taq II (TaKaRa), 2 μL of cDNA ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... SARS-COV-2 virus detection was performed using the One Step PrimeScript RT-PCR kit (TaKaRa, Japan) on the LightCycler 480 Real-Time PCR system (Roche ...
-
bioRxiv - Plant Biology 2020Quote: ... The 20-µL reaction volume comprised 10 µL 2× SYBR Green PCR Master Mix (Takara, Dalian, China), 0.2 µM each primer ...
-
bioRxiv - Immunology 2020Quote: ... the DNA-amplicons for Illumina sequencing were generated by using Advantage 2 PCR Kit (TAKARA Bio Europe), employing a mTCRβ reverse primer and a Universal primer mix (UPM) ...
-
bioRxiv - Bioengineering 2022Quote: ... Retrovirus was centrifuged for 2 hrs at 2560rcf at 320C onto wells pre-coated with RetroNectin (Takara). Wells were rinsed with PBS and CD8 T cells were added at 1×106 cells/mL in complete RPMI supplemented with 50 U/mL IL-2 and mouse T-activator Dynabeads (ThermoFisher ...