Labshake search
Citations for Takara Bio :
751 - 800 of 2300 citations for 7 bromo 1 2 3 4 tetrahydroisoquinoline 1 carboxylic acid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2019Quote: ... rabbit anti-DsRed (1:200; 632496, Clontech, Mountain View, CA, USA), mouse anti-rat CD2 (1:200 ...
-
bioRxiv - Cell Biology 2020Quote: ... 1 ug total RNA and PrimeScript RT Master Mix (Takara, Japan) was used for reverse transcription in a SimpliAmp Thermal Cycler (Life technologies ...
-
bioRxiv - Neuroscience 2020Quote: ... rabbit anti-dsRed (TaKaRa Bio, cat. no. 632496, 1:250 (57), chicken anti-GFP (Aves ...
-
bioRxiv - Plant Biology 2020Quote: pAS6 (Figure 1) carries the YFP coding region of pEYFP (Clontech) interrupted with the synthetic ...
-
bioRxiv - Genetics 2021Quote: ... washed and immunostained with rabbit Anti-dsRed (632496, Clontech; 1:1000) and/or mouse Anti-EGFP (DHSB 12A6 ...
-
bioRxiv - Cell Biology 2019Quote: The following plasmids were obtained commercially: pEGFP-C2 (Clontech #6083-1), pcDNA-EGFP-ELYS-polyA (Addgene #59746 ...
-
bioRxiv - Pathology 2021Quote: ... then loaded onto hand-packed 1 ml TALON (635507, Takara Bio) columns recirculating overnight at 1.5 ml/min ...
-
bioRxiv - Neuroscience 2019Quote: ... and rabbit anti-DsRed (1:1000, Takara Bio, Mountainview, CA, USA) primary antibodies was performed in blocking solution overnight at 4°C ...
-
bioRxiv - Genetics 2021Quote: ... probed with anti-GFP (Takara Bio Clontech, #632380, mouse, 1:5000) and anti-Tubulin (Sigma ...
-
bioRxiv - Genetics 2021Quote: ... probed with anti-GFP (Takara Bio Clontech, #632380, mouse, 1:5000) and anti-Tubulin (Sigma ...
-
bioRxiv - Microbiology 2020Quote: ... Primary anti-6xHis monoclonal mouse antibody (Clontech, 631212, diluted 1:1,000) was used to detect 6xHis-ubiquitin in samples permeabilized with 0.5% Triton-X100 ...
-
bioRxiv - Microbiology 2021Quote: ... HIV-1 viral stocks were titered by RT-qPCR (Takara #631235) to determine viral RNA copies / mL ...
-
bioRxiv - Cell Biology 2021Quote: ... Living Colors Polyclonal anti-Pan-RCFP (rabbit, 1:500, Clontech 632475), anti-GFP (chicken ...
-
bioRxiv - Cell Biology 2021Quote: ... Living Colors Polyclonal anti-mCherry/dsRed (rabbit, 1:500, Clontech 632496), Living Colors Polyclonal anti-Pan-RCFP (rabbit ...
-
bioRxiv - Genomics 2019Quote: ... 1-mM SMARTer Kit dNTP Mix (10 mM each; Clontech, 634936), 1.2-μM SMARTer Kit SMARTer II A Oligonucleotide (12 μM ...
-
bioRxiv - Neuroscience 2021Quote: ... rabbit anti-dsRed (Living Colors DsRed Polyclonal Antibody, 1:250, Clontech). Secondary antibodies were Alexa 488 ...
-
bioRxiv - Developmental Biology 2022Quote: ... the following antibodies were used: Rx (rabbit; TaKaRa, #M228; 1:1,000), Nkx2.1 (rabbit ...
-
bioRxiv - Neuroscience 2022Quote: ... rabbit anti-dsRed: (1:5000, Takara Bio, Clontech, Australia, Cat#: 632496), goat anti-mCherry (1:5000 ...
-
bioRxiv - Neuroscience 2022Quote: ... rabbit anti-dsRed: (1:5000, Takara Bio, Clontech, Australia, Cat#: 632496), goat anti-mCherry (1:5000 ...
-
bioRxiv - Neuroscience 2023Quote: ... Primary antibodies used were rabbit anti-DsRed (1:500; #632496, Takara), rat anti-mCherry (1:1000 ...
-
bioRxiv - Systems Biology 2022Quote: ... rabbit dsRed (1:500, Clonetech Takara 632496 to detect Tomato protein); mouse βTubulin (1:600 ...
-
bioRxiv - Cancer Biology 2023Quote: ... The transduced cells were selected using puromycin (1 μg/ml; Clontech) for five days ...
-
bioRxiv - Neuroscience 2023Quote: ... or rabbit anti-DsRed (1:2000; Takara Bio Cat# 632496, RRID:AB_10013483) in block at 4°C overnight ...
-
bioRxiv - Neuroscience 2023Quote: ... mouse anti-mCherry monoclonal antibody (1:500; Takara Bio Cat# 632543), Alexa Fluor 488-conjugated anti-chicken IgG antibody (1:500 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Each reaction received 1 unit Titanium Taq polymerase (TaKaRa cat. #: 638517). All steps prior to amplification were performed RNase-free ...
-
bioRxiv - Neuroscience 2023Quote: ... 1 million Lenti-X HEK293T cells (Takara Bio, cat. no. 632180) were seeded in 2 mL DMEM (Gibco ...
-
bioRxiv - Cancer Biology 2023Quote: ... retroviral supernatant was added onto retronectin-coated (1:25; #T100B TaKaRa) non-tissue culture treated plates and centrifuged at 2000 ×g for 60 min at 4 °C ...
-
bioRxiv - Cell Biology 2023Quote: ... Tet-On Inducible Expression System® plasmid (Clontech, Cat.No. 1. 634301) was linearized by digestion with EcoRI and AgeI ...
-
bioRxiv - Cell Biology 2023Quote: ... GFP (Living Colors, Takara Biotech, San Jose CA, 632375; 1:2000), Pfn1 (Abcam ...
-
bioRxiv - Neuroscience 2023Quote: ... tissues were stained using rabbit anti-dsRed (1:1000, #632496, Clontech) and mouse nc82 (1:30 ...
-
bioRxiv - Cancer Biology 2023Quote: ... to 7.5μL eluted RNA 2.5μL smRNA mix 1 (Takara Cat. #635031) and 1μL 10uM UMI RT primer (seq ...
-
bioRxiv - Cancer Biology 2023Quote: ... The antibody used was rabbit polyclonal DsRed (632496; TaKaRa, 1:500).
-
bioRxiv - Cell Biology 2023Quote: ... The supernatant was incubated with 1 ml NiNTA Superflow resin (Takara) overnight rotating at 4 °C ...
-
bioRxiv - Microbiology 2024Quote: ... and 90 μl of DNase I (1 U/μl) (TAKARA, Japan). The suspension was thoroughly re-suspended ...
-
bioRxiv - Plant Biology 2021Quote: ... whereas selective media additionally lacked His (−4) (Clontech).
-
bioRxiv - Molecular Biology 2020Quote: ... 4 μL of 5x PrimeScript buffer (Takara, USA), 1 μL RNAse OUT (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2022Quote: ... 4 ml of Lenti-X concentrator (Takara Bio) was added to 12 ml of cell supernatant and the mixture incubated at 4°C with gentle agitation for 18 hours ...
-
bioRxiv - Genomics 2022Quote: ... 3.5-4 million Lenti-X cells (Takara Bio) were seeded into 10 cm tissue culture dishes (Corning ...
-
bioRxiv - Molecular Biology 2024Quote: ... and 4 U recombinant inhibitor (Cat. 2313B, TaKaRa) or SEQURNA thermostable RNase inhibitor (Cat ...
-
bioRxiv - Molecular Biology 2021Quote: ... and the protein concentration was measured by a bicinchoninic acid (BCA) assay kit (Takara Bio) using bovine serum albumin as the standard ...
-
bioRxiv - Plant Biology 2023Quote: The cDNA prepared from 10-day-old OsbZIP48OE seedlings was used to perform 5’ and 3’ RACE using SMARTer® RACE 5’/3’ Kit (Clontech, TaKaRa Bio, USA) as per manufacturer’s instructions followed by Sanger based sequencing of the RACE products ...
-
bioRxiv - Neuroscience 2023Quote: ... 5′-GCATGTCACGATGTTACAA-3′ and 5′-GGATGAAATGAAGGTGCTA-3′ as previously described50 and were inserted using the Infusion HD Cloning kit (Takara Bio USA Inc, NC1470242).
-
bioRxiv - Cancer Biology 2023Quote: Coding regions of the heavy-chain variable domains were amplified with two PAGE-purified primers (CALL001: 5’-GTCCTGGCTGCTCTTCTACAAGG-3’ and CALL002: 5’-GGTACGTGCTGTTGAACTGTTCC-3’) using LA Taq polymerase (TAKARA Bio Inc., Shiga, Japan). The amplified fragments were separated on a 1.5% low-melting-temperature agarose gel (Lonza Group AG ...
-
bioRxiv - Immunology 2019Quote: CpG-ODN 2007 (5’-TCGTCGTTTTGTCGTTTTGTCGTT-3’) were synthesized by Takara Biotechnology (Dalian ...
-
bioRxiv - Plant Biology 2019Quote: ... Y2H assays were performed using the Matchmaker 3 system (Clontech). The resulting transformants with appropriate positive and negative controls were spotted on SD (-Leu/-Trp ...
-
bioRxiv - Cancer Biology 2020Quote: ... using the SMARTer™ ICELL8 3’ DE Kit (Takara Bio). Processing 8 samples at a time ...
-
bioRxiv - Systems Biology 2019Quote: ... and 3× PrimeScript enzyme mix (Cat# RR037A, TAKARA Bio INC) in RNase-free water ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... The 3’-RACE PCR was performed with ExTaq polymerase (TaKaRa) using the following primers ...
-
bioRxiv - Microbiology 2024Quote: The SMARTer® RACE 5’/3’ kit (Takara Bio, USA) was used to generate cDNA according to the manufacturer’s instructions using a maPgV-specific reverse primer (TGCGAGAGCCGTCAGCCACA) ...
-
bioRxiv - Cell Biology 2024Quote: Human fetal heart RNA (n=3 pooled, Cat #636532, Takara) and human adult heart RNA (n=4 pooled ...