Labshake search
Citations for Takara Bio :
601 - 650 of 2300 citations for 7 bromo 1 2 3 4 tetrahydroisoquinoline 1 carboxylic acid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Systems Biology 2023Quote: ... and 1 μl 10X Titanium Taq DNA Polymerase (Takara). The PCR conditions were ...
-
bioRxiv - Developmental Biology 2023Quote: ... rabbit anti-DsRed 1:100 (Takara Bio Clontech 632496), mouse anti-mCherry 1:100 (Takara Bio Clontech 632543) ...
-
bioRxiv - Developmental Biology 2023Quote: ... mouse anti-mCherry 1:100 (Takara Bio Clontech 632543), mouse anti-GFP 1:250 (Abcam Ab1218) ...
-
bioRxiv - Developmental Biology 2023Quote: ... rabbit anti-DsRed 1:100 (Takara Bio Clontech 632496), mouse anti-mCherry 1:100 (Takara Bio Clontech 632543) ...
-
bioRxiv - Developmental Biology 2023Quote: ... mouse anti-mCherry 1:100 (Takara Bio Clontech 632543), mouse anti-GFP 1:250 (Abcam Ab1218) ...
-
bioRxiv - Developmental Biology 2023Quote: ... and or DsRed (1/1000, Takara Bio, lot #2103116) in a solution containing 0.5% Triton-X100 ...
-
bioRxiv - Cell Biology 2023Quote: ... anti-human specific GFAP (hGFAP, TAKARA, Stem123, 1:1000), anti-AQP4 (Cell Signaling ...
-
bioRxiv - Molecular Biology 2023Quote: ... The medium was exchanged to CELLBANKER 1 plus (TaKaRa) and stored at −80°C ...
-
bioRxiv - Neuroscience 2023Quote: ... Ds-red polyclonal anti-rabbit (1:200; Takara, 632496). C1q monoclonal anti-rabbit (1:1000 ...
-
Brief Change in Dopamine Activity during Consolidation Impairs Long-Term Memory via Sleep DisruptionbioRxiv - Neuroscience 2023Quote: ... and rabbit anti-DsRed (1:200, Cat# 632496, Clontech). Secondary antibodies were Alexa Fluor 488 (goat anti-chicken ...
-
Brief Change in Dopamine Activity during Consolidation Impairs Long-Term Memory via Sleep DisruptionbioRxiv - Neuroscience 2023Quote: ... and rabbit anti-DsRed (1:200, Cat# 632496, Clontech); primary antibodies used to detect GRASP signals was mouse monoclonal anti-GFP (1:200 ...
-
bioRxiv - Plant Biology 2024Quote: ... following standard procedures (Yeast Protocols Handbook PT3024-1, Clontech). The proteins were extracted by post-alkaline methods59 and detected by western blot with antibody Myc (Abmart ...
-
bioRxiv - Molecular Biology 2024Quote: ... mouse monoclonal anti-GFP (JL8, Clontech, 632381, 1:1000) mouse monoclonal anti-vinculin (SantaCruz ...
-
bioRxiv - Molecular Biology 2024Quote: ... 0.025 U μl−1 of SeqAmp polymerase (Takara Bio) and 0.5 μM Smartseq3 forward (5′-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGATTGCGCAATG-3′ ...
-
bioRxiv - Neuroscience 2024Quote: ... and rabbit anti-dsRed (Takara Bio 632393; 1:200). Then ...
-
bioRxiv - Microbiology 2023Quote: ... 1 U/μL RNAse inhibitor (cat. no. 2313A, Takara), 5 U/μL SuperScript™ II Reverse Transcriptase (Invitrogen ...
-
bioRxiv - Microbiology 2023Quote: ... 1 U/μL RNAse inhibitor (cat. no. 2313A, Takara), 2 mM dNTPs (ThermoFisher) ...
-
bioRxiv - Genetics 2020Quote: Gal4-based Matchmaker Two-Hybrid System 3 (Clontech) was used according to manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... using MightyAmp™ DNA Polymerase Ver.3 (TaKaRa) and ND5 universal primers (Table S3) ...
-
bioRxiv - Microbiology 2022Quote: ... The two-hybrid system Matchmaker 3 from Clontech was used as per manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2019Quote: The Matchmaker Yeast Two-Hybrid System 3 (Clontech) was used for yeast two-hybrid assays to examine the p3 interaction with NbP3IP ...
-
bioRxiv - Cell Biology 2023Quote: Gal4-based Matchmaker Two-Hybrid System 3 (Clontech) was used according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2022Quote: shTnsB mutants (Fig. 7) were generated in the pHelper vector using the In-Fusion cloning kit from Takara and primers containing the desired point mutations ...
-
bioRxiv - Cell Biology 2024Quote: ... 7 μg of lentiviral vectors was mixed with a Lenti-X packaging (VSV-G) single shots tube (Clontech) in a final volume of 600 μl for 15 min before the transfection mix was added to subconfluent (80-90% ...
-
bioRxiv - Neuroscience 2020Quote: ... Primary antibodies were directed against IBA1 (rabbit-anti-iba1 WAKO chemicals 019-19741 1:1000) and tdTomato (mouse-anti-dsRed Takara 632392 1:1000). Secondary antibodies were goat anti-rabbit or anti-mouse conjugated with Alexa dyes 488 and 568 (1:1000) ...
-
bioRxiv - Neuroscience 2021Quote: ... anti-nc82 (mouse, 1:10; Developmental Studies Hybridoma Bank, Iowa City, IA, USA) and anti-DsRed (rabbit, 1:500; Takara Bio, Kyoto, JP). Brains were washed three times again in PBS with 0.2% Triton X-100 and transferred into secondary antibody solution (anti-chicken Alexa Fluor 488 ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... with 0.1 µL of Taq Polymerase 5 U.µL-1 (TaKaRa Ex Taq® Kit MgCl2 Free Buffer) (TaKaRa Ex Taq, TaKaRa Bio, Shiga, Japan), 2.5 µL PCR Buffer 10X ...
-
bioRxiv - Neuroscience 2023Quote: ... the brain slices were first blocked in 10% goat serum made in 0.1% Triton X-100/1× PBS and then incubated in anti-GFP antibodies (1/1000, RT, overnight, Mouse anti-GFP, 632381, Takara Bio USA, WI) followed by Alexa-488 secondary antibodies (1/200 ...
-
bioRxiv - Neuroscience 2023Quote: ... the samples were incubated in primary antibody (chicken anti-GFP, Abcam #13970, 1:2000, rabbit anti-DsRed, Takara Bio Clontech #632496, 1:200) for 24 – 48 hours in the dark while shaking at 4 °C ...
-
bioRxiv - Neuroscience 2023Quote: ... the samples were incubated in primary antibody (chicken anti-GFP, Abcam #13970, 1:2000, rabbit anti-DsRed, Takara Bio Clontech #632496, 1:200) for 24 – 48 hours in the dark while shaking at 4 °C ...
-
bioRxiv - Neuroscience 2023Quote: ... Tissues were rinsed four times for 15 min each with 0.1 M PBS and incubated with secondary antibodies anti-DsRed (1:500; RRID:AB_10013483; Living Colors DsRed polyclonal; Takara Bio USA, San Jose, CA) and anti-Troma1 (1:500 ...
-
bioRxiv - Bioengineering 2023Quote: ... the input binary libraries (1:10 or 1:100) and the selected pools were subjected to restriction digestion using BamHI (Takara Bio Inc., Japan). The digestion products were then analyzed using a 10% polyacrylamide gel electrophoresis (PAGE ...
-
bioRxiv - Genetics 2021Quote: Adult ovary total RNA was used to amplify the 5’ and 3’ UTR of Pxmeiw68 and PxnanosP using the SMARTer RACE 5’/3’ Kit (Takara, Japan). 5’ and 3’ regulatory sequences were then cloned from 4th instar larval gDNA ...
-
bioRxiv - Microbiology 2019Quote: ... (5’-GGT CTC TCT GGT TAG ACC AGA TCT GAG C-3’ and 5’-AAA CAT GGG TAT TAC TTC TGG GCT GAA AG-3’) using PrimeSTAR®HS (TAKARA) and purified by QIAquick Gel Extraction (QIAGEN) ...
-
bioRxiv - Evolutionary Biology 2021Quote: First amplified with primers 27F (5’-AGAGTTTGATCMTGGCTCAG-3’) and 1492R (5’-GGTTACCTTGTTACGACTT-3’) using EmeraldAmp GT PCR Master Mix (TAKARA BIO) to minimize the amplification of non-bacterial taxa under the following cycling conditions ...
-
bioRxiv - Biochemistry 2020Quote: ... The target 23-mer sequences for sgRNA used were 5’-TTTACCTTGATAGGTGGTAGTGG - 3’and 5’-ATAAAGAGAGGCTTCTCGGGAGG - 3’ and synthesized using Guide-it™ sgRNA In Vitro Transcription Kit (TaKaRa) according to manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2021Quote: ... D4H was generated by site-directed mutagenesis using the primers 5’-TGTTTTAGATTGATAATTTCCATCCCATGTTTT-3’ and 5’-CGGACTCAGATCTCGAAGGGAAAAATAAACTTAGA-3’ and inserted into pEGFP-C2 vector (TaKaRa Bio) by the In-Fusion reaction ...
-
bioRxiv - Cell Biology 2021Quote: ... was amplified from HEK293 cDNA by PCR using the primers 5’-TGTAAGCTTTTCGACACCACACCCCACTC-3’ and 5’-AGAGAATTCTCAGGAAAAGCTGTCATCGG-3’ and was inserted into pEGFP-C3 vector (TaKaRa Bio) using EcoRI and HindIII ...
-
bioRxiv - Microbiology 2019Quote: The 5’ and 3’ RACE analyses were performed according to the protocol for the SMARTer® RACE 5’/3’ Kit (TaKaRa Bio USA ...
-
Dynamic states of eIF6 and SDS variants modulate interactions with uL14 of the 60S ribosomal subunitbioRxiv - Biochemistry 2022Quote: ... pRSFDUET-1-EIF6 plasmid was co-transformed with pG-KJE8 expressing five bacterial chaperones (5-Ch: DnaK-DnaJ-GrpE, GroES, GroEL) or pG-TF2 expressing 3 bacterial chaperones (3-Ch: GroES, GroEL, TF) (Takara Biosciences) in BL21 (DE3 ...
-
bioRxiv - Neuroscience 2022Quote: ... sad-1 was cloned into PCR8 vector using the following primers 5’ TCCGAATTCGCCCTTCGTCAATCGGGCAAAGTC 3’ and 3 ’GTCGAATTCGCCCTTGATGATAGATTAGACTTTATCAGCC 5’ with help of infusion reaction (Takara, 638947). For making Pmec-7::mec-7::gfp (cDNA ...
-
bioRxiv - Animal Behavior and Cognition 2024Quote: ... with the PCR product of the W56-EGFP-Linker-Synapsin1a region from pAAV-hSyn1-W56-EGFP-Linker-Synapsin1a (FWD and REV primers: 5’-GGCGCGCCCTAGAATTTCAGTCGGAGAAGAGGCTGGC-3’ and 5’-ATGCTAGGCCACCATGATGGTGGACGGCAAGCCC-3’, respectively) using In-Fusion cloning (TaKaRa Bio). pAAV-hSyn1-DIO-Scr-EGFP-Linker-Synapsin1a was generated by replacing the TurboID region of pAAV-hSyn1-DIO-TurboID (EcoRI/NcoI sites ...
-
bioRxiv - Developmental Biology 2019Quote: ... 2 mM dithiothreitol (Clontech), 2 μM template switching oligo (Exiqon) ...
-
bioRxiv - Molecular Biology 2024Quote: ... 2 (Takara, Shiga, Japan) and 0.32 µM of each primer according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2020Quote: ... Then subsequent primary antibody incubation was done overnight at 4 degrees (all primary antibodies were diluted in 1% blocking milk or for Phos-tag with MBL Max blot solution 1 or Takara Western blot immune booster). Proteins of interest were detected with Anti-Rabbit IgG HRP (Cell signaling technologies ...
-
bioRxiv - Cell Biology 2023Quote: ... crossed with WT BDF1 males at E0.5 and electroporated with RNP complex of Mavs targeting sgRNA (100 ng μL-1) and Cas9 protein (Takara Bio; 500 ng μL-1) using NEPA21 electroporator ...
-
bioRxiv - Genomics 2021Quote: ... 4 ul 2.5 μM dNTP mixture (Takara), 0.8 ul 100mM DTT and 14.2 ul RNase-free water ...
-
bioRxiv - Microbiology 2022Quote: ... and 4 μM random hexamer primers (Takara Bio ...
-
bioRxiv - Microbiology 2020Quote: ... and 4) TaKaRa LA Taq (TaKaRa RR042). For each library ...
-
bioRxiv - Molecular Biology 2020Quote: ... was amplified using specific primers (forward: 5’-AAGGAGATATACATATGCTCTCCGAAATGGTGGAAGAAG-3’; reverse:5’-GTGCGGCCGCAAGCTTTTATTTCTTTTTGTTGGTGGTCTG-3’) and cloned into pET28a using an InFusion HD Cloning Kit (Takara Bio USA) as per the manufacturer’s instructions ...