Labshake search
Citations for Takara Bio :
701 - 750 of 5174 citations for Arg8 Vasopressin AVP ELISA Kit 5 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: The In-Fusion cloning kit (Takara Bio) was used according to manufacturer’s guideline to clone cDNAs into pUASTattB (kindly provided by K ...
-
bioRxiv - Biophysics 2023Quote: ... The Capturem EV isolation mini kit (Takara) was used following the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2023Quote: ... CDNA was generated with PrimeScript kit (Takara). SYBR Green SuperMix (Bio-Rad ...
-
bioRxiv - Neuroscience 2023Quote: ... or In-Fusion HD Cloning Kit (TaKaRa). The GFP-fused full-length NCAN-expressing plasmid was constructed by inserting the fragment encoding GFP amplified from the pCAG-GFP vector into the central region of NCAN (corresponding to Val641 to Leu644) ...
-
bioRxiv - Plant Biology 2024Quote: ... using Yeastmaker™ Yeast Transformation kit (Clontech), and transformants were selected on double dropout medium SD/-Leu/-Trp at 30°C for three-days ...
-
bioRxiv - Molecular Biology 2024Quote: ... using Random Primer DNA Labeling Kit (TaKaRa), according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2024Quote: ... using CalPhosTM mammalian transfection kit (Clontech #631312) and incubated for 16 hours ...
-
bioRxiv - Microbiology 2024Quote: ... In- Fusion HD Cloning Kit (Clontech 639649), and XL10-Gold Ultracompetent E ...
-
bioRxiv - Microbiology 2024Quote: ... using the Great EscAPe SeAP kit (Takara).
-
bioRxiv - Microbiology 2024Quote: ... using the Great EscAPe SeAP kit (Takara). T test was used to determine that only samples transfected with Rta induced significant viral reactivation (p<0.05 compared to Vec) ...
-
bioRxiv - Bioengineering 2022Quote: HEK293T cells were harvested for RNA extraction using RNeasy Plus Mini Kit (Qiagene) or NucleoSpin RNA Plus Kit (Takara). RNA concentration was measured by nanodrop and 500ng to 1000ng total RNAs were used for reverse transcription in 10 ul reaction volume by High-Capacity RNA-to-cDNA kit (ThermoFisher) ...
-
bioRxiv - Neuroscience 2021Quote: ... Reverse transcription (RT) was then initiated with the cDNA synthesis kit (PrimeScript™ 1st strand cDNA Synthesis Kit; Takara) using the random hexamers option ...
-
bioRxiv - Microbiology 2021Quote: ... RNA was converted to cDNA with the PrimeScript™ RT reagent Kit Prime Script TMRT reagent Kit (Takara, Japan), and the cDNA was analyzed by qRT-PCR using TB Green® Premix Ex TaqTM II (Takara ...
-
bioRxiv - Immunology 2021Quote: ... Cells were harvested after 3 d and AAV6 was purified with a filtration-based kit (Takara AAVpro Purification Kit) per the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2022Quote: ... The extracted probes were radioactively labeled with 2.5 μl [alpha-32P] dCTP (Amersham) according to the instructions of the kit (LaddermanTM Labeling Kit, Takara). The probe was mixed with 100 μl TE buffer (10mM ...
-
bioRxiv - Molecular Biology 2022Quote: ... library preparation was performed using the SMARTER Stranded Total RNA Seq kit v2-Pico Input Mammalian kit (Takara Bio) following the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2022Quote: ... and His (-HTLA) but containing 5-bromo-4-chloro-3-indolyl α-D-galactopyranoside (Clontech, Madison, WI, USA). As a control ...
-
bioRxiv - Cell Biology 2019Quote: Chimeras 1-5 were first generated in pBluescript by In-Fusion cloning (Takara Bio, USA, Mountain View, CA) of inserts encoding different fragments of human Myo1e PCR-amplified from pEGFP-C1-myo1e-EcoR1-into the PCR-amplified segments of pBS-SpMyo1 vector using primers designed to replace selected SpMyo1 domain sequences with corresponding HsMyo1e sequences ...
-
bioRxiv - Plant Biology 2020Quote: ... Total RNA was isolated from seedlings and ligated to the 5’ RNA adaptor by T4 RNA ligase (TaKaRa). Reverse transcription was performed with 9-nt random primers and the cDNA amplified by PCR with an adaptor primer and a gene-specific primer ...
-
bioRxiv - Biophysics 2021Quote: ... and sgRNA were cultured at 37°C and 5% CO2 in high-glucose Dulbecco’s modified Eagle’s medium (DMEM, HyClone) supplemented with 10% (v/v) FBS (ClonTech), 250 µg/ml hygromycin ...
-
bioRxiv - Cancer Biology 2020Quote: ... three replicate wells of 5□×□104 cells per well were seeded in a retronectin (Takara Bio Inc, JPY) coated 24-well XF24 plate ...
-
bioRxiv - Biochemistry 2020Quote: ... The supernatant was supplemented with 5 mM imidazole pH 8.0 before incubation with Co2+ charged TALON resin (Clontech) for 1 h on a rotator (1 ml resin slurry per L original culture volume) ...
-
bioRxiv - Physiology 2021Quote: ... mixed with 5 μl lysis buffer (0.2% Triton X-100, with 2 U/μl recombinant RNase inhibitor, Clontech) at the end of the collection and were immediately snap-frozen on dry ice ...
-
A bacterial derived plant- mimicking cytokinin hormone regulates social behaviour in a rice pathogenbioRxiv - Microbiology 2021Quote: ... 5 μg of total RNA was reverse transcribed into cDNA using EcoDryTM Premix (Clontech, Mountain View, CA, USA) according to the manufacturer’s instructions using random hexamer primers ...
-
bioRxiv - Genomics 2022Quote: ... in which 5 pmol of substrate primer and 12,5 µl of TB Green Premix Ex Taq II (Takara) were added ...
-
bioRxiv - Plant Biology 2022Quote: ... and histidine (H) and containing 5-Bromo-4-Chloro-3-Indolyl α-D-galactopyranoside (X-α-gal) (Clontech) to detect interactions ...
-
bioRxiv - Cancer Biology 2022Quote: CPT1a knockdown cell lines were generated using the shRNA-expressing lentiviral pLKO-shRNA2 vector (No. PT4052-5; Clontech), with a puromycin selection cassette ...
-
bioRxiv - Genomics 2023Quote: ... Primary antibodies were diluted in 5% milk in PBS-T + 0.01% sodium azide (1:2,000 for mouse anti-GFP (Clontech) and mouse anti-3V5 (Invitrogen) ...
-
bioRxiv - Cell Biology 2023Quote: ... the single-stranded DNA (5’-AATTCAAAGAATTAACCTTAATTGAA GGGGAGGGTTCAGTACTTTTGTGTAGTACAAATATCAGTACTTTTGTGTAGTACAAAA GGGAGGGCTTCAATTAAGGTTAATTCTTTG-3’) was treated with T4 DNA ligase (Takara, Beijing, China) after annealing ...
-
bioRxiv - Bioengineering 2023Quote: ... T cells were mixed with lentivirus at multiplicity of infection (MOI) equal to 5 in Retronectin (Takara, T100B)-coated culture plates and centrifuged at 1800 g for 1 h at 32 °C for lentiviral transduction before returning to normal culture condition ...
-
bioRxiv - Plant Biology 2023Quote: ... Ade and His but containing 5-Bromo-4-Chloro-3-indolyl a-D-galactopyranoside (X-a-gal) (Clontech). To detect interactions ...
-
bioRxiv - Cell Biology 2022Quote: Mitochondrial network morphology was assessed transfecting hPASMC grown on a 60 mm plate to 50% confluence with 1 μg pDsRed2-mito expression vector (Clontech Laboratories, 632421) and 2 μL Lipofectamine™ 2000 (ThermoFisher Scientific ...
-
bioRxiv - Cell Biology 2019Quote: ... Viral supernatant was harvested 48 h after transfection and added to 6 well plates that had been precoated with 15 μg/ml RetroNectin (Takara Bio Inc.) and blocked with 2% BSA ...
-
bioRxiv - Genomics 2020Quote: ... cells were loaded onto a source plate and dispensed in to a SMARTer ICELL8 350 v chip (Takara Bio USA, Cat. # 640019) at 35 nanoliter per well ...
-
bioRxiv - Cancer Biology 2020Quote: ... were loaded into each well of a 384-well plate (A1 through D2) and dispensed 50nL per well into a 5,184 well SMARTer™ ICELL8® 3’ DE Chip (Takara Bio) using the ICELL8® Multisample NanoDispenser (MSND ...
-
bioRxiv - Biochemistry 2020Quote: A yeast displayed cDNA library that concurrently displays NanoLuc (diversity ∼6×106) was constructed using DNA amplified from the Clontech Mate & Plate Library-Universal Mouse (Normalized) cDNA library (Takara Bio Inc). The yeast library was generated using the previously described lithium acetate yeast transformation method (63) ...
-
bioRxiv - Neuroscience 2021Quote: ... at P11 were transduced in a 6 well plate using 300 µl of Auto-hLAG3 LV pre-incubated with 30 µl of Lenti-X™ Accelerator (Clontech #631256) for 30 min ...
-
bioRxiv - Cell Biology 2022Quote: ... Viral supernatant was harvested 48 h after transfection and added to 6 well plates that had been precoated with 15 μg/ml RetroNectin (Takara Bio Inc.) and blocked with 2% BSA ...
-
bioRxiv - Synthetic Biology 2019Quote: ... and the supernatants were transferred to a new 96-well plate with 50 μl Talon resin in each well (Takara Bio, Japan). Unspecific binding of proteins to the resin was reduced by adding imidazole to a final concentration of 10 mM in each well ...
-
bioRxiv - Immunology 2020Quote: ... Cells were counted and seeded at 3 million cells in 1 mL of media with 2x hIL-2 into each well of a 6 well plate that was coated with 15 µg/mL of RetroNectin (Takara, Cat# T100A) for 3 hours at room temperature and subsequently washed with 1x PBS ...
-
bioRxiv - Genetics 2020Quote: ... Mouse Hsf2bp cDNA was subcloned into the vector pGBKT7 and was used as bait to screen a mouse testis Mate & Plate cDNA library (Clontech Laboratories Inc.). Positive clones were initially identified on double dropout SD (synthetic dropout)/–Leu/–Trp/X-α-Gal/Aureobasidin A plates before further selection on higher stringency quadruple dropout SD/–Ade/–His/–Leu/–Trp/X-α-Gal/Aureobasidin A plates ...
-
bioRxiv - Plant Biology 2023Quote: A Y2H library screen was performed as outlined in the Matchmaker Gold “Mate and Plate” Yeast Two-Hybrid System (Takara Bio Inc.) using pGBKT7-CML13 as the bait in yeast strain AH109 ...
-
bioRxiv - Immunology 2022Quote: ... The day before transduction, a non-tissue culture treated 24-well plate (Grener Bio one, #662102) was coated with retronectin (Takara Bio, #T100B) in PBS (7μg/ml ...
-
bioRxiv - Plant Biology 2023Quote: ... and on a SD-Leu-Trp-Ade-His plate containing X-α-gal and supplemented with 0.2 µg/ml Aureobasidin A (Takara Bio, USA). Plates were imaged after incubation for 60–72 hr at 30 °C ...
-
bioRxiv - Neuroscience 2024Quote: ... and individual cells were captured in separate wells of a 96-well plate containing 4 μl lysis buffer (1 U/μl RNase inhibitor [Clontech, Cat#: 2313B]), 0.1% Triton (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2019Quote: Total RNA was isolated (HiPure Plant RNA MIni Kit, Magen) and reverse transcribed (The PrimeScript® RT reagent Kit, Takara). Two pairs of primers (5′-GGCAAGAATCATCACGACCAG-3′ and 5′-GTATGCCATGAGGTCGTCCAC-3′ ...
-
bioRxiv - Genetics 2021Quote: Total RNA was extracted from wing discs of individual silkworms at the wandering stage using the MicroElute Total RNA Kit (OMEGA) and reverse transcription was performed using the PrimeScript RT reagent Kit (Takara). qRT-PCR experiments were performed using Hieff SYBR Green Master Mix (YEASEN) ...
-
bioRxiv - Microbiology 2021Quote: ... Remaining DNA was removed using the TURBO DNA-free kit (Thermo-Scientific) and cDNA generated using the PrimeScript cDNA synthesis kit (Takara). qRT-PCR reactions were set up according to the manufacturer’s instructions (Alkali Scientific) ...
-
bioRxiv - Developmental Biology 2020Quote: ... Libraries were prepared using the SMART-Seq v3 Ultra Low RNA Input Kit for Sequencing and the Low Library Prep Kit v1 from Clontech. For the an3 RNAseq experiment ...
-
bioRxiv - Molecular Biology 2020Quote: ... the cDNAs were produced using BioRad Reverse Transcription Kit (iScriptTM Reverse Transcription Supermix) or the PrimeScript RT reagent kit (RR037A, TaKaRa). cDNAs from HEK and THP89 cells were quantified by quantitative PCR using Bio Rad’s SsoAdvanced Universal SYBR Green Supermix ...