Labshake search
Citations for Takara Bio :
701 - 750 of 2909 citations for 9 10 Dihydro 4H benzo 4 5 cyclohepta 1 2 b thiophen 4 one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2020Quote: ... 2 μL of the RT reaction was combined with 2.5 μL of 10X Advantage 2 buffer (Takara), 2.5 μL of 2.5 mM dNTPs (Takara) ...
-
bioRxiv - Microbiology 2019Quote: ... and then prehybridized in 5 mL ExpressHyb (ClonTech) for 1 hour at 65°C ...
-
bioRxiv - Genetics 2019Quote: ... containing 5 μL 2X SYBR master mix (Takara), 30ng genomic DNA ...
-
bioRxiv - Microbiology 2020Quote: ... 0.5 μl 5 U/μl Taq polymerase (Takara) and nuclease-free water to 30 μl ...
-
bioRxiv - Developmental Biology 2020Quote: ... and once in 5 ml NDiff227 (Takara Y40002). mESCs were then pelleted by centrifugation for 5’ at 1000rpm and resuspended in 500µl of NDiff227 ...
-
bioRxiv - Molecular Biology 2023Quote: 5 ml TALON metal affinity resin (TaKaRa Bio) was equilibrated with five column volumes of native lysis buffer ...
-
bioRxiv - Biochemistry 2023Quote: ... 5 mM ATP (Takara, sodium salt, pH 7.0), and 0.5 mM NADPH (Roche ...
-
bioRxiv - Microbiology 2023Quote: ... 5 U/µL Ex Taq polymerase (TaKaRa, Japan), 20 mg/mL BSA (Roche ...
-
bioRxiv - Cell Biology 2023Quote: ... A total of 1-2 μg RNA was reverse transcribed with random hexamers using PrimeScript 1st strand cDNA synthesis kit (Takara Bio, Japan) per the manufacturer’s protocol on Verti 96 well thermocycler (Thermo Scientific ...
-
bioRxiv - Neuroscience 2021Quote: ... Quantification of P11+1 SH-10 cells showed that 76% of cells were expressing hLAG3 upon induction by 1 µg/ml of Doxycycline (DOX; Clontech #631311). This decreased to 59% in P11+2 and remained around 50% in the following passages ...
-
bioRxiv - Cell Biology 2023Quote: ... 30 cycles of 98 °C for 10 sec followed by 68 °C for 1 min using PrimeSTAR HS DNA Polymerase with GC buffer (Takara, R044A). The primers used for the purpose of inserting Capn4 into pCWX200 and pLexA were ...
-
bioRxiv - Cell Biology 2023Quote: ... 30 cycles of 98 °C for 10 sec followed by 68 °C for 1 min using PrimeSTAR HS DNA Polymerase with GC buffer (Takara, R044A). The primers used were as follows ...
-
bioRxiv - Cell Biology 2023Quote: ... The lentivirus was produced in DMEM containing 10% FBS and 1% BSA and then concentrated by the Lenti-X concentrator (Takara Bio).
-
bioRxiv - Synthetic Biology 2024Quote: ... The mixture (1 μL) was used as the template in 10 μL of PrimeSTAR GXL DNA Polymerase (Takara Bio Inc., Japan) reaction ...
-
bioRxiv - Genomics 2024Quote: Illumina sequencing libraries are prepared by incorporating 1-10 ng of cfDNA with the ThruPLEX® Plasma-seq Kit by Takara Bio ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... with 0.1 µL of Taq Polymerase 5 U.µL-1 (TaKaRa Ex Taq® Kit MgCl2 Free Buffer) (TaKaRa Ex Taq, TaKaRa Bio, Shiga, Japan), 2.5 µL PCR Buffer 10X ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: Site-directed mutagenesis in GC-A and GC-B and construction of chimeric receptors were performed through use of the In-Fusion HD plus cloning kit (Takara Bio Inc.). The primers used are listed in Supplementary Table 1 ...
-
bioRxiv - Plant Biology 2023Quote: ... The resulting fragments were cloned into vector backbones derived from pPY22 (mNeonGreen-Hygromycin B) or pPY23 (mNeonGreen-Nourseothricin) using the In-Fusion Snap Assembly Kit (Takara, cat. 638948). For PpREN knockout ...
-
bioRxiv - Genetics 2021Quote: Adult ovary total RNA was used to amplify the 5’ and 3’ UTR of Pxmeiw68 and PxnanosP using the SMARTer RACE 5’/3’ Kit (Takara, Japan). 5’ and 3’ regulatory sequences were then cloned from 4th instar larval gDNA ...
-
bioRxiv - Evolutionary Biology 2021Quote: First amplified with primers 27F (5’-AGAGTTTGATCMTGGCTCAG-3’) and 1492R (5’-GGTTACCTTGTTACGACTT-3’) using EmeraldAmp GT PCR Master Mix (TAKARA BIO) to minimize the amplification of non-bacterial taxa under the following cycling conditions ...
-
bioRxiv - Biochemistry 2020Quote: ... The target 23-mer sequences for sgRNA used were 5’-TTTACCTTGATAGGTGGTAGTGG - 3’and 5’-ATAAAGAGAGGCTTCTCGGGAGG - 3’ and synthesized using Guide-it™ sgRNA In Vitro Transcription Kit (TaKaRa) according to manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2021Quote: ... D4H was generated by site-directed mutagenesis using the primers 5’-TGTTTTAGATTGATAATTTCCATCCCATGTTTT-3’ and 5’-CGGACTCAGATCTCGAAGGGAAAAATAAACTTAGA-3’ and inserted into pEGFP-C2 vector (TaKaRa Bio) by the In-Fusion reaction ...
-
bioRxiv - Cell Biology 2021Quote: ... was amplified from HEK293 cDNA by PCR using the primers 5’-TGTAAGCTTTTCGACACCACACCCCACTC-3’ and 5’-AGAGAATTCTCAGGAAAAGCTGTCATCGG-3’ and was inserted into pEGFP-C3 vector (TaKaRa Bio) using EcoRI and HindIII ...
-
bioRxiv - Microbiology 2019Quote: The 5’ and 3’ RACE analyses were performed according to the protocol for the SMARTer® RACE 5’/3’ Kit (TaKaRa Bio USA ...
-
bioRxiv - Microbiology 2020Quote: ... The 5’ RACE reaction was performed with an ac13-specific primer (ac13-GSP1) using a SMARTer® RACE 5’/3’ Kit (TaKaRa) according to the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2022Quote: ... sad-1 was cloned into PCR8 vector using the following primers 5’ TCCGAATTCGCCCTTCGTCAATCGGGCAAAGTC 3’ and 3 ’GTCGAATTCGCCCTTGATGATAGATTAGACTTTATCAGCC 5’ with help of infusion reaction (Takara, 638947). For making Pmec-7::mec-7::gfp (cDNA ...
-
bioRxiv - Animal Behavior and Cognition 2024Quote: ... with the PCR product of the W56-EGFP-Linker-Synapsin1a region from pAAV-hSyn1-W56-EGFP-Linker-Synapsin1a (FWD and REV primers: 5’-GGCGCGCCCTAGAATTTCAGTCGGAGAAGAGGCTGGC-3’ and 5’-ATGCTAGGCCACCATGATGGTGGACGGCAAGCCC-3’, respectively) using In-Fusion cloning (TaKaRa Bio). pAAV-hSyn1-DIO-Scr-EGFP-Linker-Synapsin1a was generated by replacing the TurboID region of pAAV-hSyn1-DIO-TurboID (EcoRI/NcoI sites ...
-
bioRxiv - Evolutionary Biology 2023Quote: Complete cDNA sequences of taste receptors were obtained using a SMARTer 5’/3’ kit for RACE PCR to obtain 5’ sequence information missing from reference transcriptome (Takara, #634858). Briefly ...
-
bioRxiv - Plant Biology 2020Quote: ... The yeast one-hybrid (Y1H) assay was conducted using the Matchmaker™ Gold Yeast One-Hybrid Library Screening System kit (Cat. no. 630491, Clontech).
-
bioRxiv - Plant Biology 2019Quote: ... One microgram of DNA-free RNA was used to synthesize cDNA by using PrimeScriptTM RT Reagent Kit (TAKARA, Kusatsu, Shiga, Japan).
-
bioRxiv - Plant Biology 2022Quote: ... The recombinant constructs was transformed into Y1H gold strain and Y1H assay was performed using Matchmaker® Gold Yeast One-hybrid screening system (Takara) following the manufacturer’s protocol ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... and each RNA concentration was measured by quantitative PCR after reverse transcription using PrimeScript One Step RT-PCR Kit (TaKaRa, Japan) with specific primers (Table S2) ...
-
bioRxiv - Molecular Biology 2021Quote: ... Gene expression in the cDNA samples was measured by one-step qRT-PCR using a One Step PrimeScript RT-PCR Kit (Perfect Real Time) according to the manufacturer’s specifications (Takara, Dalian, China). Quantitative real-time PCR was performed on the CFX Connect Real-Time PCR Detection System (Bio-Rad ...
-
bioRxiv - Biochemistry 2019Quote: ... the URAT1/SLC22A12 gene promoter region was amplified using KOD One PCR Master Mix (TOYOBO) or PrimeSTAR® Max DNA Polymerase (Takara) with the following primers ...
-
bioRxiv - Microbiology 2022Quote: ... was used as the template for real-time RT-PCR performed according to the manufacturer’s protocol using the One Step TB Green PrimeScript PLUS RT-PCR kit (Takara, Cat# RR096A) and the following primers ...
-
bioRxiv - Microbiology 2022Quote: ... The PCR product was purified and ligated into the pET15b vector with a C-terminal His tag to create plasmid pET-AdpA by using the ClonExpress™ II One Step Cloning Kit (TaKaRa). The plasmid was transformed into E ...
-
bioRxiv - Immunology 2022Quote: ... added with RT-PCR master mix and IgG VH/VL primers per well and performed with RT-PCR following the one step RT-PCR kit protocol (Takara, RR057A). Then ...
-
bioRxiv - Neuroscience 2021Quote: ... Up to a maximum of 50 cells were sorted into one well filled with 9uL of Clontech lysis buffer (Single-cell lysis buffer 10x, #635013 Takara Bio) + 5% RNAse inhibitor (40U/ul ...
-
bioRxiv - Microbiology 2021Quote: ... The supernatant or RNA were directly used for one-step RT-qPCR using PrimeDirect™ Probe RT-qPCR Mix (TaKaRa, Japan) according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... was used as the template for real-time RT-PCR performed according to the manufacturer’s protocol using the One Step TB Green PrimeScript PLUS RT-PCR kit (Takara, cat# RR096A) and the following primers ...
-
bioRxiv - Plant Biology 2019Quote: Y1H assays were carried out using the Matchmaker Gold yeast one hybrid Library Screening System (Biosciences Clontech, Palo Alto, CA, USA). The PRH1 promoter was inserted into the pAbAi vector ...
-
bioRxiv - Molecular Biology 2021Quote: ... One ng of DNA was used for real-time qPCR analysis using Premix Ex Taq DNA polymerase (Takara, cat. no. RR039W) on ABI Fast 7500 (Applied Biosystems® ...
-
bioRxiv - Genetics 2021Quote: Isolated RNA from OSF and control tissues was immediately subjected to realtime RT PCR (using Takara PrimescriptTM one step realtime RT PCR kit) (Takara, Japan) analysis for detection of changes in expression of NQO1 mRNA according to the manufacturers protocol ...
-
bioRxiv - Microbiology 2021Quote: ... was used as the template for real-time RT-PCR performed according to the manufacturer’s protocol using the One Step TB Green PrimeScript PLUS RT-PCR kit (Takara, Cat# RR096A) and the following primers ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... qRT-PCR was performed by using One Step SYBR® PrimeScript® PLUS RT-RNA PCR Kit (TaKaRa Biotechnology, Dalian, China). Relative expression levels were analyzed by using the 2−ΔΔCT method.
-
bioRxiv - Microbiology 2020Quote: ... then subjected to quantitative real-time RT-PCR using a One-Step SYBR PrimeScript RT-PCR kit II (Takara Bio, Japan). The PCR mixture was mixed with 2 μl of extracted RNA and DENV-specific primer (38 ...
-
bioRxiv - Microbiology 2021Quote: ... First the coding region of Candid #1 RdRp was amplified using RNA extracted from P0 or P11 viruses and the PrimeScript II High Fidelity One Step RT-PCR Kit (Takara Bio). Kozak sequence ...
-
bioRxiv - Neuroscience 2020Quote: ... One microgram of total RNA for each sample was reversely transcribed into cDNA by a commercial kit (RR047A, Takara Bio, Japan) according to the manufacturer’s protocol ...
-
Deletion or inhibition of PTPRO mitigates diet-induced hepatic steatosis and inflammation in obesitybioRxiv - Immunology 2022Quote: The inducible cell lines expressing WT or mutants of vimentin were established by the Tet-One Inducible Expression System (Clontech, USA) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2022Quote: ... NM_001123007) was amplified from 24 hpf embryo RNA using the PrimeScript II High Fidelity One Step RT-PCR kit (Takara, R026A) and the following primers ...