Labshake search
Citations for Takara Bio :
601 - 650 of 2909 citations for 9 10 Dihydro 4H benzo 4 5 cyclohepta 1 2 b thiophen 4 one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... 5′-RACE cDNA was obtained from bulk-sorted splenic B cells of each mouse with the SMART-Seq v4 Ultra Low Input RNA Kit for Sequencing (TaKaRa). The IgG PCRs were set up with Platinum Taq High-Fidelity DNA Polymerase (Life Technologies ...
-
bioRxiv - Immunology 2021Quote: ... 5’ s-RACE cDNA was obtained from bulk-sorted B cells of each mouse with the SMART-Seq v4 Ultra Low Input RNA Kit for Sequencing (TaKaRa). The IgG PCRs were set up with Platinum Taq High-Fidelity DNA Polymerase (Life Technologies ...
-
bioRxiv - Microbiology 2019Quote: ... 5’-RACE cDNA was obtained from bulk-sorted splenic B cells of each mouse with SMART-Seq v4 Ultra Low Input RNA Kit for Sequencing (TaKaRa). The immunoglobulin PCRs were set up with Platinum Taq High-Fidelity DNA Polymerase (Life Technologies ...
-
bioRxiv - Developmental Biology 2020Quote: ... and then further into the ClaI site of the avian replication-competent retrovirus vector RCASBP(B) (Li, Monckton, & Godbout, 2014) with the In-Fusion HD cloning kit (Clontech). The mutant construct that converts glutamine (Q ...
-
bioRxiv - Microbiology 2020Quote: ... 5′-RACE cDNA was obtained from bulk-sorted B cells of each animal with SMART-Seq v4 Ultra Low Input RNA Kit for Sequencing (TaKaRa). The Ig PCRs were set up with Platinum Taq High-Fidelity DNA Polymerase (Thermo Fisher ...
-
bioRxiv - Immunology 2020Quote: ... 10ng of RNA was used to prepare bulk TCR-seq libraries using the SMARTer Mouse TCR a/b Profiling Kit (Takara) according to instructions ...
-
bioRxiv - Immunology 2023Quote: ... A cDNA library for TCR was prepared from RNA using a SMARTer Mouse TCR a/b Profiling Kit (Takara Bio) according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2023Quote: ... cDNA libraries were generated using SMARTer Human TCR a/b Profiling Kit v2 (Takara Bio USA, San Jose, California, USA). Briefly ...
-
bioRxiv - Bioengineering 2023Quote: ... GA-MatryoshCaMP6s was amplified from pRSET B His-GA-MatryoshCaMP6s and subcloned into pDONR /Zeo via In-Fusion cloning (Takara Bio ...
-
bioRxiv - Cancer Biology 2020Quote: ... phospho-specific mutant constitutively active NFATC4 17 was also cloned into the doxycycline-inducible Tet-One expression system (Clontech) to create an inducible and constitutive NFATC4 (IcNFATC4 ...
-
bioRxiv - Immunology 2021Quote: ... and one deletion mutant Δ39-59 were made by mutation PCR with PrimerSTAR Max DNA Polymerase (Takara, Beijing, China) and pdsRed-p17 as the template ...
-
bioRxiv - Cell Biology 2020Quote: ... cDNA was synthesized using a PrimeScript II High Fidelity One Step RT-PCR Kit (R026A, Takara Bio, Shiga, Japan), purified using a QIAquick PCR Purification Kit (QIAGEN ...
-
bioRxiv - Biophysics 2021Quote: ... using KOD One PCR Master Mix (TOYOBO) was subcloned into the AgeI- and NotI-digested EGFP-N1 vector (Clontech), and subsequently full-length EGFR fragment was subcloned into the NheI- and HindIII-digested the LgBiT-inserted EGFP-N1 vector ...
-
bioRxiv - Biochemistry 2022Quote: One μg of RNA per kidney half was reverse-transcribed using PrimeScript RT Reagent kit (RR037 TAKARA, Shiga, Japan). Two μl of cDNA was used for quantitative real-time PCR to assess gene mRNA expression ...
-
bioRxiv - Molecular Biology 2019Quote: ... One microgram of total RNA was used for preparing cDNA using PrimeScript™ 1st strand cDNA Synthesis Kit (Clontech) following the manufacturer’s protocol.
-
bioRxiv - Molecular Biology 2021Quote: ... One microgram of total RNA was reverse transcribed by the PrimeScript RT Reagent Kit with gDNA Eraser (Takara, RR047A). Quantitative PCR was performed in technical duplicates with FastStart Essential DNA Green Master Mix (Roche ...
-
Guidelines for accurate genotyping of SARS-CoV-2 using amplicon-based sequencing of clinical samplesbioRxiv - Genomics 2020Quote: ... CDC-USA assay targeting gene N (IDT # 10006713) and One Step PrimeScript™ III RT-PCR Kit (TaKaRa #RR600A). Serial dilutions of reference material were prepared ranging from 1 to ~10M genome equivalents per reaction ...
-
bioRxiv - Microbiology 2022Quote: ... Viral load was measured by RT-qPCR using One-Step SYBR® Primescript(tm) RT-PCR kit II (Takara). CT values from serum samples were used to calculate serum viral load according to regression equation built by a set of standard viral RNA extracted from dilutions of known titre virus preparation ...
-
bioRxiv - Developmental Biology 2023Quote: ... TRE3Gs and Tet-ON 3G were amplified by PCR from AAVpro Tet-One Luc Control Vector (Clontech, Cat# 634311), Kaede from in-house recombineering cassette (Zheng et al. ...
-
bioRxiv - Evolutionary Biology 2021Quote: The 5’ and 3’ ends of Cpun_dsx were amplified using the SMARTer RACE 5’/3’kit (TaKaRa, Shiga, Japan) and gene-specific primers designed for OD2 (“Cpun_dsx OD2 5’RACE” and “Cpun_dsx OD2 3’RACE” ...
-
bioRxiv - Cancer Biology 2020Quote: ... sgRNA sequences were amplified from 240μg of genomic DNA per sample with primers 5’AATGGACTATCATATGCTTACCGTAACTTGA AAGTATTTCG and 5’GTAATTCTTTAGTTTGTATGTCTGTTGCTAT TATG and ExTaq (Takara) polymerase ...
-
bioRxiv - Cell Biology 2021Quote: ... The HBV core protein coding region was amplified using the forward primer 5’-ATCATAAGCTTACCATGGACATCGACCCTTATAAAG-3’ and reverse primer 5’-TAGATGGTACCCTAACATTGAGGTTCCCGAG-3’ and subcloned into the pcDNA3.1 vector (Clontech) via HindIII and KpnI restriction sites ...
-
bioRxiv - Cancer Biology 2022Quote: ... using 5′-GGGTTAGGGATAGGCTTAC-CACCGGTTTACTTGTACAGCTCGTCCATGC -3′ and 5′-CTTGTACAAAGTGGTTACCGGAGGATC-CGGTGGTGTGAGCAAGGGCGAGGAGCTG -3′ primers for PCR and In-Fusion Cloning (Takara Bio). The pStrep-ANKLE1 plasmid was obtained by cloning annealed oligonucleotides containing Twin-Strep-tag (5′ CCGGTCACCATGGCGTGGAGCCACCCGCAGTT-CGAGAAAGGTGGAGGTTCCGGAGGTGGATCGG-GAGGTTCGGCGTGGAGCCACCCGC-AGTTCGAAAAAGC 3′ and 5′ GGCCGCTTTTTCGAACTGC-GGGTGGCTCCACGCCGAACCTCCCGAT-CCACCTCCGGAACCTCCACCTTTCTCGAA-CTGCGGGTGGCTCCACGCCATGGTGA 3′ ...
-
bioRxiv - Cell Biology 2023Quote: ... about ∼5 μg of bacmid were transfected using 5 μL of TransIT®-Insect transfection reagent (Takara Bio Inc.). 5 days after initial transfection ...
-
bioRxiv - Cell Biology 2023Quote: ... about ∼5 μg of bacmid were transfected using 5 μL of TransIT®-Insect transfection reagent (Takara Bio Inc.). 5 days after initial transfection ...
-
bioRxiv - Biochemistry 2024Quote: ... about ∼5 μg of bacmid were transfected using 5 μL of TransIT®-Insect transfection reagent (Takara Bio Inc.). 5 days after initial transfection ...
-
bioRxiv - Cell Biology 2021Quote: γ2 mCherry and tethered GluA2 (flop isoform)::γ260 were subcloned into the doxycycline-inducible expression vector pBI-Tet (Clontech, #6152-1) using the restriction sites MluI/XbaI and MluI/NheI ...
-
bioRxiv - Microbiology 2020Quote: ... 1 μl sense and 1 μl anti-sense primers of 100 μM each were mixed with 2 μl 10X Taq polymerase PCR buffer (Takara, Japan) and 16 μl ultra-pure water to a final volume of 20 μl ...
-
bioRxiv - Neuroscience 2023Quote: ... Total RNA (1–2 µg) was reverse transcribed using random hexamers and the PrimeScript™ 1st strand cDNA Synthesis Kit (TaKaRa). RT-qPCR was performed using a StepOnePlus qPCR system (Applied Biosystems ...
-
bioRxiv - Neuroscience 2021Quote: ... Groups of 6-10 cells were dispensed from the micropipette into 1 µl ice-cold 10x reaction buffer (SMART-Seq v4 kit, Takara) and flash-frozen before library preparation ...
-
miR-125-chinmo pathway regulates dietary restriction dependent enhancement of lifespan in DrosophilabioRxiv - Molecular Biology 2020Quote: ... The synthesized cDNA was diluted (1:10) and used as template for quantitative real-time PCR (qRT-PCR) using SYBR premix EX-Taq-plus (TaKara) and analyzed on QuantStudio 6 Real-Time PCR machine (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2021Quote: ... Virus was then concentrated from the media 1:10 in PBS using Lenti-X concentrator (Takara Bio, Cat. No. 631231), aliquoted and stored at −80°C for future use.
-
bioRxiv - Cell Biology 2021Quote: ... following patch-clamp cells were collected using a separate wide-bore collection pipette (0.2-0.5 MOhm) filled with lysis buffer (10% Triton, ribonuclease inhibitor 1:40; Clontech, Cat#2313A), ERCC RNA spike-in mix (1:600000 ...
-
bioRxiv - Cancer Biology 2022Quote: ... cDNAs were diluted 1/10 and PCR reactions were conducted using SYBR qPCR Premix Ex Taq II Tli RNase H+ (TAKRR820W, Takara). Primers can be found in Supplementary Table 4 ...
-
bioRxiv - Molecular Biology 2019Quote: ... 2 (TaKaRa bio. Inc., Shiga, Japan). The vector was transformed into XL1-Blue Escherichia coli competent cells (GMbiolab Co. ...
-
bioRxiv - Molecular Biology 2019Quote: ... 2 (Dye Plus; TaKaRa, Dalian, Japan), according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: ... Lenti-X concentrator (PT4421-2, Clontech) was mixed at the ratio of 1:3 and incubated at 4 °C for a short time ...
-
bioRxiv - Cell Biology 2021Quote: ... and doxycycline (2 mg/ml, Clontech). After 6 hours ...
-
bioRxiv - Developmental Biology 2022Quote: ... 2 mM DTT (Takara Bio, #639537), 1 mM dNTPs (Takara Bio ...
-
bioRxiv - Cell Biology 2021Quote: ... containing doxycycline (2 mg/ml, Clontech). We kept the cells in this medium for 5 days ...
-
bioRxiv - Bioengineering 2023Quote: ... 2 µg pantropic pVSV-G (Clontech), 3 µg pCL- (Imgenex) ...
-
bioRxiv - Biochemistry 2023Quote: ... 2 Units of Exonuclease III (Takara) were added to 1ug of NCPs in ExoIII digestion buffer (50 mM Tris– HCl (pH 8.0) ...
-
bioRxiv - Immunology 2023Quote: ... 2 µL 100 µM DTT (Takara), 2 µL 10 µM template switching oligo ...
-
bioRxiv - Immunology 2023Quote: ... version 2 (Takara cat. no. 634411) and mRRBS library preparation was performed using custom procedures previously described by our group (23 ...
-
bioRxiv - Molecular Biology 2024Quote: ... and 2 U recombinant inhibitor (TaKaRa) for samples containing biological inhibitor ...
-
bioRxiv - Microbiology 2019Quote: ... flanked by a 5’ terminal Kozak sequence and 3’ terminal stop codon into the Nhe1 and Sal1 sites of pIRES2-EGFP (Clontech cat # 6029-1).
-
bioRxiv - Genetics 2019Quote: 3000 quiescent satellite cells were lysed after FACS by sorting directly into a 0.2ml tube containing 1 μl SMART-Seq Reaction Buffer (95% SMART-Seq 10x lysis buffer containing 5% SMART-Seq RNAse Inhibitor, Takara Bioscience, Cat. 634890) in 8μl ddH20 ...
-
bioRxiv - Plant Biology 2019Quote: ... 1.5 kb) was amplified with P1 and P2 primers (see Supplementary Table 1) from Col genomic DNA using PrimeStarMax (Takara Bio, Kusatsu, Japan) and inserted in HindIII-XbaI digested pGWB51131 by the SLiCE method32 to give p511G1pro ...
-
bioRxiv - Cancer Biology 2022Quote: ... After 48 hours supernatants were collected and employed to LAL-B cells in Retronectin (Takara Bionic Otsu, Shiga 520-2193, Japan) pre-coated no tissue culture 24-well plates (Falcon ...
-
bioRxiv - Molecular Biology 2021Quote: ... with 10% FBS (TaKaRa, 631106). HCT116 OsTIR1 cells (kindly provided by Masato Kanemaki ...