Labshake search
Citations for Takara Bio :
601 - 650 of 1199 citations for Anti Integrin beta 5 Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... We used mouse anti-GFP (Takara) at 1:1000 dilution ...
-
bioRxiv - Neuroscience 2023Quote: ... rabbit anti-DsRed (1:1000, Clontech), mAb anti-Bruchpilot (nc82 ...
-
bioRxiv - Developmental Biology 2023Quote: ... anti-Ocn (Takara, M173; 1:800), anti-CD31 (BD ...
-
bioRxiv - Cell Biology 2023Quote: ... mouse anti-GFP (Clontech,1:6,000), mouse anti-FLAG (Millipore-Sigma ...
-
bioRxiv - Cancer Biology 2022Quote: ... pre-cleared by centrifugation at 1000xg for 5 min and concentrated by 40X using Lenti-X (Takara) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2019Quote: ... We added 5 μl of transformants (107/mL) on SD/–Leu/–Trp (Clontech, Mountain View, CA, USA) and SD/–Ade/– His/–Leu/–Trp (3 mM 3-AT ...
-
bioRxiv - Evolutionary Biology 2019Quote: Templates for mRNA in situ hybridization probes were cloned by PCR or SMARTer 3’/5’-RACE (Clontech) from cDNA or genomic DNA (see Supplemental File 1 for details) ...
-
bioRxiv - Cancer Biology 2020Quote: ... cDNA was synthesized from 5 ng of total RNA using the PrimeScript Reverse Transcriptase (Takara by Clontech) and a mix of random hexamers - oligo dT primer ...
-
bioRxiv - Cancer Biology 2020Quote: ... cDNA was synthesized from 5 ng of total RNA using the PrimeScript Reverse Transcriptase (Takara by Clontech) and a mix of random hexamers - oligo dT primer ...
-
bioRxiv - Developmental Biology 2022Quote: ... PGCs and EGCs were lysed at room temperature for 5 minutes in lysis buffer (Takara Bio, #635013) containing RNAse inhibitors (Takara Bio ...
-
bioRxiv - Cell Biology 2022Quote: ... and 5 units of SMART Moloney murine leukemia virus reverse transcriptase (Takara Bio, Mountain View, CA, USA). The RT reaction was carried out at 42°C for 2 hrs ...
-
bioRxiv - Bioengineering 2020Quote: The cleared lysate was poured on 5 mL packed Ni-NTA agarose (His60 Superflow, TaKaRa Bio Europe) gravity flow columns ...
-
bioRxiv - Pathology 2020Quote: ... and 5 units of SMART Moloney murine leukemia virus reverse transcriptase (Takara Bio, Mountain View, CA, USA). The RT reaction was carried out at 42°C for 2 hrs ...
-
bioRxiv - Immunology 2021Quote: ... wild-type SARS-CoV-2 RBD was purified using a 5 mL HisTALON superflow cartridge (Takara Bio) followed by size exclusion chromatography using a Superdex 200 10/300 GL column pre-equilibrated in 20 mM Tris-HCl pH 7.5 ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... with 0.1 µL of Taq Polymerase 5 U.µL-1 (TaKaRa Ex Taq® Kit MgCl2 Free Buffer) (TaKaRa Ex Taq ...
-
bioRxiv - Microbiology 2023Quote: ... We next cloned the synthesized DNA into the pDON-5 Neo-vector (TaKaRa, Kusatsu, Japan, Cat# 3657), which was pre-linearized with NotI-HF (New England Biolabs [NEB] ...
-
Comprehensive mutational analysis of the checkpoint signaling function of Rpa1/Ssb1 in fission yeastbioRxiv - Genetics 2023Quote: ... the supernatant was loaded onto a 5 ml column with prewashed Talon resin (Clontech Laboratories, Inc, CA). The column was washed three times with the low pH buffer (pH 6.3) ...
-
bioRxiv - Cell Biology 2023Quote: ... pseudonana (PtPyShell1, TpPyShell1, and TpPyShell2) were determined by RACE using a SMARTer RACE 5’/3’ kit (TaKaRa). Sequences were amplified by PCR and cloned into pPha-T1 or pTha-NR vectors containing a fragment of enhanced GFP by a seamless ligation cloning extract method (Motohashi ...
-
bioRxiv - Cancer Biology 2023Quote: ... RT-PCR was performed using diluted cDNA (1:5 in water) and PrimeStar DNA Polymerase (Takara, R010A) with primers and PCR conditions listed in Table 1 ...
-
bioRxiv - Molecular Biology 2023Quote: ... For quantitative RT-PCR 1ug of total RNA was treated with 5 Units of DNase I (Takara) and cDNA synthesized with SuperScriptIII (Life Technologies ...
-
bioRxiv - Molecular Biology 2024Quote: ... or 5 ng of total RNA (with a SMARTer Stranded Total RNA-Seq Kit v3; Takara Bio) was used.
-
bioRxiv - Cell Biology 2020Quote: Mouse monoclonal E-cadherin antibody (HECD-1) was purchased from Takara Bio Inc ...
-
bioRxiv - Genetics 2019Quote: ... GAL4 DNA-BD Mouse Monoclonal Antibody (Takara Bio USA, Inc. #630403), and GAPDH Mouse Monoclonal Antibody (CB1001-500UG 6C5 ...
-
bioRxiv - Neuroscience 2020Quote: ... The following primary antibodies were used: GFP (JL-8, Clontech, #632381), Tubulin (Covance ...
-
bioRxiv - Developmental Biology 2022Quote: ... and/or mCherry (Living Colors DsRed Polyclonal Antibody #632496, Takara, Japan) after in situ hybridization were carried out as described in (Chen Q et al. ...
-
bioRxiv - Bioengineering 2022Quote: ... EGFP was detected using the JL-8 mouse monoclonal antibody (Clontech). For IHC ...
-
bioRxiv - Developmental Biology 2022Quote: ... the following antibodies were used: Rx (rabbit; TaKaRa, #M228; 1:1,000), Nkx2.1 (rabbit ...
-
bioRxiv - Cancer Biology 2023Quote: ... The antibody used was rabbit polyclonal DsRed (632496; TaKaRa, 1:500).
-
bioRxiv - Plant Biology 2024Quote: ... We then ran a western blot using the GFP antibody (Takara living colors EGFP monoclonal antibody JL-8 ...
-
bioRxiv - Microbiology 2020Quote: ... cDNA was generated following the SMARTer® 5’/3’ RACE kit protocol (Takara Bio, Kusatsu, Shiga Prefecture, Japan).
-
bioRxiv - Plant Biology 2022Quote: ... and His (-HTLA) but containing 5-bromo-4-chloro-3-indolyl α-D-galactopyranoside (Clontech, Madison, WI, USA). As a control ...
-
bioRxiv - Cell Biology 2019Quote: Chimeras 1-5 were first generated in pBluescript by In-Fusion cloning (Takara Bio, USA, Mountain View, CA) of inserts encoding different fragments of human Myo1e PCR-amplified from pEGFP-C1-myo1e-EcoR1-into the PCR-amplified segments of pBS-SpMyo1 vector using primers designed to replace selected SpMyo1 domain sequences with corresponding HsMyo1e sequences ...
-
bioRxiv - Plant Biology 2020Quote: ... Total RNA was isolated from seedlings and ligated to the 5’ RNA adaptor by T4 RNA ligase (TaKaRa). Reverse transcription was performed with 9-nt random primers and the cDNA amplified by PCR with an adaptor primer and a gene-specific primer ...
-
bioRxiv - Biophysics 2021Quote: ... and sgRNA were cultured at 37°C and 5% CO2 in high-glucose Dulbecco’s modified Eagle’s medium (DMEM, HyClone) supplemented with 10% (v/v) FBS (ClonTech), 250 µg/ml hygromycin ...
-
bioRxiv - Biophysics 2022Quote: ... 3’-RACE-Ready cDNA template was synthesized using a SMARTer® RACE 5’/3’ Kit (Takara Bio, USA) and subsequently used to amplify 3’ end sequences of R ...
-
bioRxiv - Cancer Biology 2020Quote: ... three replicate wells of 5□×□104 cells per well were seeded in a retronectin (Takara Bio Inc, JPY) coated 24-well XF24 plate ...
-
bioRxiv - Immunology 2022Quote: ... IGK and IGL 5’RACE AIRR-seq libraries were generated using the SMARTer Mouse BCR Profiling Kit (Takara Bio ...
-
bioRxiv - Biochemistry 2020Quote: ... The supernatant was supplemented with 5 mM imidazole pH 8.0 before incubation with Co2+ charged TALON resin (Clontech) for 1 h on a rotator (1 ml resin slurry per L original culture volume) ...
-
bioRxiv - Physiology 2021Quote: ... mixed with 5 μl lysis buffer (0.2% Triton X-100, with 2 U/μl recombinant RNase inhibitor, Clontech) at the end of the collection and were immediately snap-frozen on dry ice ...
-
A bacterial derived plant- mimicking cytokinin hormone regulates social behaviour in a rice pathogenbioRxiv - Microbiology 2021Quote: ... 5 μg of total RNA was reverse transcribed into cDNA using EcoDryTM Premix (Clontech, Mountain View, CA, USA) according to the manufacturer’s instructions using random hexamer primers ...
-
bioRxiv - Developmental Biology 2022Quote: Rapid amplification of cDNA end (RACE) was performed using the SMARTer® RACE 5’/3’ Kit (Takara, #634858). 1ug of freshly isolated RNA from E8.5 embryo hearts was used to generate first strand cDNA according to the manufactural protocol ...
-
bioRxiv - Genomics 2022Quote: ... in which 5 pmol of substrate primer and 12,5 µl of TB Green Premix Ex Taq II (Takara) were added ...
-
bioRxiv - Plant Biology 2022Quote: ... and histidine (H) and containing 5-Bromo-4-Chloro-3-Indolyl α-D-galactopyranoside (X-α-gal) (Clontech) to detect interactions ...
-
bioRxiv - Cancer Biology 2022Quote: CPT1a knockdown cell lines were generated using the shRNA-expressing lentiviral pLKO-shRNA2 vector (No. PT4052-5; Clontech), with a puromycin selection cassette ...
-
bioRxiv - Cell Biology 2023Quote: ... and used for library preparation (5-10 ng) using SMART-Seq v4 Ultra Low Input RNA Kit (Clontech). Libraries were sequenced on Novaseq platform (Illumina).
-
bioRxiv - Cell Biology 2023Quote: ... the single-stranded DNA (5’-AATTCAAAGAATTAACCTTAATTGAA GGGGAGGGTTCAGTACTTTTGTGTAGTACAAATATCAGTACTTTTGTGTAGTACAAAA GGGAGGGCTTCAATTAAGGTTAATTCTTTG-3’) was treated with T4 DNA ligase (Takara, Beijing, China) after annealing ...
-
bioRxiv - Bioengineering 2023Quote: ... T cells were mixed with lentivirus at multiplicity of infection (MOI) equal to 5 in Retronectin (Takara, T100B)-coated culture plates and centrifuged at 1800 g for 1 h at 32 °C for lentiviral transduction before returning to normal culture condition ...
-
bioRxiv - Plant Biology 2023Quote: ... Ade and His but containing 5-Bromo-4-Chloro-3-indolyl a-D-galactopyranoside (X-a-gal) (Clontech). To detect interactions ...
-
bioRxiv - Molecular Biology 2023Quote: ... The 5’ and 3’ ends of the cDNA were amplified using the SMARTer RACE cDNA Amplification Kit (Clontech) according to the manufacturer’s guidelines ...
-
bioRxiv - Cell Biology 2023Quote: The full-length cDNA expression library was constructed using the SMARTer RACE 5’/3’ Kit (Takara Bio, 634858) according to the manufacturer’s instructions for the In-Fusion SMARTer Directional cDNA Library Construction Kit (Takara Bio ...