Labshake search
Citations for Takara Bio :
551 - 600 of 1199 citations for Anti Integrin beta 5 Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... and 5 µg RNA was reverse transcribed into cDNA using a cDNA synthesis kit (Takara Bio) as per the manufacturer’s instructions ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... and deposited into a PCR tube with 5 μL lysis buffer (Takara Bio, San Francisco, CA). cDNAs were then prepared by reverse transcriptase (Takara Bio ...
-
bioRxiv - Plant Biology 2023Quote: ... 1 μg total RNA was reverse transcribed into cDNA with the SMARTer RACE 5’ Kit (Clontech). PCR was performed using primer GSP-HO1 and the Universal Primer Mix (UPM ...
-
bioRxiv - Molecular Biology 2023Quote: ... The solution was treated with 5 μg/mL RNaseA and 70 unit/ml DNase I (Takara) for 1 h at 37°C ...
-
bioRxiv - Immunology 2024Quote: ... The TCR sequences were then isolated using 5’RACE (SMARTer RACE cDNA Amplification Kit, Takara Bio), followed by PCR amplification with primers designed to be complementary to TRAC (GTTGCTCCAGGCAATGGCCCCATTGCTC ...
-
bioRxiv - Neuroscience 2023Quote: ... Rabbit primary anti-RFP (anti-DsRed Living Colors, 632496, Takara, Mountain View, CA, 1:1000) was followed with donkey anti-rabbit AF594 (715-586-152 ...
-
bioRxiv - Cell Biology 2020Quote: ... and GFP was probed with the monoclonal JL8 antibody (Takara) and anti-mouse HRP conjugate secondary (Promega W401B) ...
-
bioRxiv - Physiology 2020Quote: ... followed by incubation with DsRed Polyclonal Antibody (Takara Bio # 632496) overnight in PBST (0.2% ...
-
bioRxiv - Neuroscience 2019Quote: ... Primary antibodies used were: rat monoclonal mCherry (1:2000, Clontech); mouse monoclonal tyrosine hydroxylase (TH ...
-
bioRxiv - Plant Biology 2020Quote: ... the YFP protein was detected using the GFP antibody (Clontech) at 1/5,000th and the UGPase antibody (Agrisera ...
-
bioRxiv - Cell Biology 2022Quote: ... mouse GFP antibody (Clontech, clone JL8, used at 1:4,000) was obtained from Takara (Saint-Germain-en-Laye ...
-
bioRxiv - Genetics 2020Quote: ... using monoclonal antibodies against Cas9 (Clontech, Palo Alto, CA, USA) or GFP (Sigma) ...
-
bioRxiv - Cell Biology 2020Quote: Mouse GFP antibody (Clontech, clone JL8, used at 1:4,000) was obtained from Takara (Saint-Germain-en-Laye ...
-
bioRxiv - Neuroscience 2023Quote: ... Green Fluorescent Protein (GFP) antibody (JL-8, 1:500, Clontech), Red Fluorescent Protein Antibody (DsRed ...
-
bioRxiv - Neuroscience 2023Quote: ... a Living Colors® EGFP mouse monoclonal antibody (632569, Clontech), or a mouse monoclonal anti-actin antibody (clone AC-40 ...
-
bioRxiv - Neuroscience 2023Quote: ... and Living Colors® DsRed Polyclonal Antibody (1:200, Clontech). BrdU ...
-
bioRxiv - Cell Biology 2024Quote: ... Primary antibodies were diluted using Solution 1 (Takara, NKB-101). Secondary antibodies used for immunoblotting included peroxidase AffiniPure Goat Anti-Rabbit IgG (H+L ...
-
bioRxiv - Developmental Biology 2024Quote: ... Primary antibodies used were CDH1 (E-CADHERIN) (M106, Takara Biosciences) for glandular and luminal epithelial staining ...
-
bioRxiv - Genetics 2024Quote: ... its antibody was removed by stripping buffer (Takara Bio #T7135A) and re-blotted by PKcs antibody to quantify the total amount of DNA-PKcs (See Figures S2I-L).
-
bioRxiv - Neuroscience 2021Quote: ... rabbit anti-dsred (1/1000; TaKaRa), mouse anti-acetylated Tubulin (1/500 ...
-
bioRxiv - Cell Biology 2021Quote: ... mouse JL8 anti-GFP (Clontech, 632381); mouse P124 anti-desmoglein 1 (Progen ...
-
bioRxiv - Neuroscience 2022Quote: ... rabbit anti-DsRed (1:100, Clontech).
-
bioRxiv - Neuroscience 2019Quote: ... rabbit anti-DsRed (1:250; Clontech), mouse anti-ratCD2 (OX-34 ...
-
bioRxiv - Cell Biology 2019Quote: ... mouse anti-GFP (Clontech, 1:5000) rat anti-RFP (Chromotek ...
-
bioRxiv - Neuroscience 2019Quote: ... Rabbit anti-Dsred (1:250, Takara Bio ...
-
bioRxiv - Neuroscience 2019Quote: ... rabbit anti-DsRed (1:500; Clontech), mouse anti-rCD2 (OX-34 ...
-
bioRxiv - Neuroscience 2019Quote: ... rabbit anti-DsRed (1:1000, Clontech), mouse mAb anti-ChAT (1:100 ...
-
bioRxiv - Developmental Biology 2019Quote: ... rabbit anti-RFP (1:1,000, Clontech), mouse monoclonal anti-Bruchpilot ...
-
The Ets protein Pointed P1 represses Asense expression in type II neuroblasts by activating TaillessbioRxiv - Developmental Biology 2021Quote: ... rabbit anti-DesRed (Catalog #632392, Takara Bio USA ...
-
bioRxiv - Biochemistry 2021Quote: ... anti-mCherry (632543, Takara, 1:1,000), anti-SUMO2/3 (ab3742 ...
-
bioRxiv - Developmental Biology 2021Quote: ... anti-DsRed (1/500, 632496, Clontech), anti-cleaved caspase-3 (1/500 ...
-
bioRxiv - Neuroscience 2019Quote: ... rabbit anti-RFP 1:500 (Clontech), anti-GFP 1:1000 (Nacalai Tesque) ...
-
Programmed ER fragmentation drives selective ER inheritance and degradation in budding yeast meiosisbioRxiv - Cell Biology 2021Quote: ... anti-GFP JL8 (Clontech, 1:2000), anti-V5 (Invitrogen ...
-
bioRxiv - Neuroscience 2022Quote: ... rabbit anti-Dsred (1:200)(Takara), mouse anti-Lacz (1:200)(Promega) ...
-
bioRxiv - Developmental Biology 2022Quote: ... rat anti-E-Cadherin (TAKARA; M110), rat anti-Endomucin (Santa Cruz ...
-
bioRxiv - Neuroscience 2021Quote: ... anti-DsRed (Clontech, rabbit 1:500), anti-PV (Sigma PARV-19 ...
-
bioRxiv - Neuroscience 2021Quote: ... rabbit anti-dsRed (Clontech, 1:1000), goat anti-HRP-Cy5 (Dianova ...
-
bioRxiv - Neuroscience 2020Quote: ... rabbit anti-DsRed (Clontech, 1:1000), or mouse anti-brp (nc82 ...
-
bioRxiv - Developmental Biology 2022Quote: ... and rabbit anti-dsRed (Takara, 632496) (1:200 ...
-
bioRxiv - Pathology 2022Quote: ... Rat anti Mouse OCN (Takara, M188); Rabbit anti Mouse MGST1 (Abcam ...
-
bioRxiv - Developmental Biology 2019Quote: ... rabbit anti-DsRed (1:500; Clontech) and rat anti-GFP (1:500 ...
-
bioRxiv - Cell Biology 2019Quote: ... mouse anti-GFP monoclonal JL8 (Clontech), mouse anti-myc (Cell Signaling Technologies) ...
-
bioRxiv - Developmental Biology 2020Quote: ... anti-dsRed (Clontech #632496, 1:300), anti-c-Myc (Santa Cruz #SC40 ...
-
bioRxiv - Physiology 2020Quote: ... rabbit anti-dsRed 1:250 (Clontech), Cy-3 anti-rabbit 1:400 (Millipore) ...
-
bioRxiv - Developmental Biology 2021Quote: ... rabbit anti-dsRed (1:400, Clontech), and mouse anti-GFP (1:200 ...
-
bioRxiv - Neuroscience 2023Quote: ... anti-FOXG1 (1:500, rabbit; Takara), anti-MAP2 (1:500 ...
-
bioRxiv - Plant Biology 2022Quote: ... and anti-GFP (632381; Clontech, USA) antibodies ...
-
bioRxiv - Neuroscience 2023Quote: ... anti-Crx (rabbit; 1:200; Takara), anti-Recoverin (rabbit ...
-
bioRxiv - Cell Biology 2023Quote: ... rabbit anti-Myc (1:1000) (Clontech); rabbit anti-HA (1:800 ...
-
bioRxiv - Neuroscience 2022Quote: ... Rabbit anti-Dsred (Takara, Cat# 632496), Goat anti-GFP (Abcam ...