Labshake search
Citations for Takara Bio :
551 - 600 of 2560 citations for Human Chemokine C X C Motif Receptor 5 CXCR5 Protein since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Physiology 2022Quote: ... A total of 5 μg of each protein was subjected to trypsin treatment using a captured trypsin column (TAKARA, 635722, Shiga, Japan). After trypsin treatment ...
-
bioRxiv - Cell Biology 2020Quote: ... with the following primers (forward 5’ GAATTCAGATCTATGGTGAGCAAGGGCGAG and reverse 5’ gaattcagatctcttgtacagctcgtccatg) or (forward 5’ GAATTCAGATCTATGGTGAGCAAGGGCGAGGAG and reverse 5’ gaattcagatctcttgtacagctcgtccatgccg) using pEGFP (Clontech) or pCMV-mCherry2 (Clontech ...
-
bioRxiv - Microbiology 2020Quote: Human embryonic kidney 293T (Clontech, 632180), human lung carcinoma A549 (ATCC ...
-
bioRxiv - Developmental Biology 2024Quote: ... Human cDNA was purchased from Clontech. The cDNAs were used for PCR with rTaq polymerase (TaKaRa) ...
-
bioRxiv - Cancer Biology 2021Quote: ... HEK293T Lenti-X cells were purchased from Takara. Primary mouse melanoma cell lines were isolated from mouse melanomas ...
-
bioRxiv - Cell Biology 2019Quote: ... and concentrated 20x with Lenti-X Concentrator (Takara). Lentivirus was used immediately or kept at −80°C ...
-
bioRxiv - Molecular Biology 2020Quote: ... Viruses were concentrated using Lenti-X Concentrator (Clontech). One volume of Lenti-X Concentrator was combined with three volumes of clarified supernatant ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... and concentrated with Lenti-X concentrator (Takara Bio). Titration reactions using varying amounts of lentivirus were conducted on each cell type to determine the best volume to add ...
-
bioRxiv - Cell Biology 2022Quote: ... and Lenti-X 293T cells were from Clontech. No commonly misidentified cell line was used in this study ...
-
bioRxiv - Developmental Biology 2022Quote: ... were concentrated using Lenti-X− Concentrator (631232, Takara) and pellets were dissolved in 400 µl PBS.
-
bioRxiv - Developmental Biology 2022Quote: ... and titer estimation (Lenti-X Expression System, Clontech). An AAV virus that constitutively expresses eGFP from CMV promoter (Addgene ...
-
bioRxiv - Genomics 2019Quote: ... and concentrated 10x with Lenti-X (Clontech, 63123). 2×105 WT mESCs were incubated with 0.2 ml concentrated lentivirus and polybrene (8 μg/ml) ...
-
bioRxiv - Cancer Biology 2019Quote: ... 6×106 Lenti-X 293T (Takara Bio #632180) cells were seeded in a 10 cm dish the day prior to transfection ...
-
bioRxiv - Cancer Biology 2019Quote: ... Lenti-X 293T cells were obtained from Clontech, and maintained in DMEM media (Hyclone or Gibco ...
-
bioRxiv - Developmental Biology 2020Quote: ... concentrated using the Lenti-X concentrator (Clontech, 631231), and stored at −80°C.
-
bioRxiv - Neuroscience 2020Quote: ... Lenti-X 293T cells (Cat. No. 632180, Clontech) were plated on 5-10 cm dishes ...
-
bioRxiv - Microbiology 2021Quote: ... and concentrated using Lenti-X-Concentrator (Takara Bio). Prior to infection of target cells ...
-
bioRxiv - Neuroscience 2020Quote: ... concentrated overnight at 4C with Lenti-X (Clontech) as per manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2021Quote: ... Lenti-x-293 Cell Line (Clontech Laboratories, 632180) were cultured in Dulbecco’s modified Eagle’s medium (DMEM ...
-
bioRxiv - Biophysics 2022Quote: ... Virus was concentrated using Lenti-X Concentrator (Takara) and resuspended in DPBS before being applied to neurons.
-
bioRxiv - Biochemistry 2020Quote: ... Lenti-X 293T cells (Takara Bio, MountainView, CA) were transiently transfected with 17.8 µg of pLKO.1 TRC-DsRed ...
-
bioRxiv - Cell Biology 2021Quote: ... concentrated using Lenti-X Concentrator (Takara Bio Europe) and titered on IMCD3 cells using GFP-expressing lentivirus ...
-
bioRxiv - Microbiology 2021Quote: ... and HEK 293T Lenti-X (Clontech/Takara Bio) were cultured at 37°C in 5% CO2 in Dulbecco’s modified Eagle’s medium (DMEM ...
-
bioRxiv - Microbiology 2021Quote: ... and HEK 293T Lenti-X (Clontech/Takara Bio) were cultured at 37°C in 5% CO2 in Dulbecco’s modified Eagle’s medium (DMEM ...
-
bioRxiv - Bioengineering 2022Quote: ... Lenti-X 293T cells were purchased from Takara and cultured according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: ... Lenti-X 293T cells were obtained from Clontech, and maintained in DMEM media (Hyclone or Gibco ...
-
bioRxiv - Bioengineering 2022Quote: ... Lenti-X 293T cells were purchased from Takara and cultured according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2020Quote: ... Viruses were concentrated using Lenti-X concentrator (Takara) and resuspended with phosphate-buffered saline ...
-
bioRxiv - Neuroscience 2021Quote: ... with Lenti-X packaging single shots (Takara Bio), and concentrated using Lenti-X concentrator (Takara Bio ...
-
bioRxiv - Cancer Biology 2020Quote: ... followed by Lenti-X™ Concentrator (Takara Bio) mediated concentration ...
-
bioRxiv - Genetics 2022Quote: ... and concentrated with Lenti-X Concentrator (Takara, 631231) according to manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... Retro-X-Tet-on Inducible Expression System (Clontech) was used according to the manufacturer’s instruction ...
-
LIR-dependent LMX1A/LMX1B autophagy crosstalk shapes human midbrain dopaminergic neuronal resiliencebioRxiv - Cell Biology 2019Quote: ... Viruses were concentrated using Lenti-X Concentrator (Clontech). One volume of Lenti-X Concentrator was combined with three volumes of clarified supernatant ...
-
bioRxiv - Neuroscience 2019Quote: ... lentiviruses were concentrated with Lenti-X concentrator (Takara), resuspended in sterile PBS ...
-
bioRxiv - Cancer Biology 2019Quote: ... concentrated with Lenti-X concentrator (Takara Bioscience, 631231) and viral titers were incubated with AMO-1 cells ...
-
bioRxiv - Cell Biology 2020Quote: ... 293T cells (Lenti-X, Takara, San Francisco, CA) and HCT116 cells (Stewart-Ornstein and Lahav ...
-
bioRxiv - Neuroscience 2020Quote: ... lentiviruses were concentrated with Lenti-X concentrator (Takara), resuspended in sterile PBS ...
-
bioRxiv - Biochemistry 2019Quote: NIH3T3s (ATCC) and Lenti-X 293T cells (Clontech) were grown in DMEM supplemented with 10% FBS ...
-
bioRxiv - Microbiology 2022Quote: ... then concentrated using the Lenti-X concentrator (Takara) according to the manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2021Quote: ... HEK293T Lenti-X cells were purchased from Takara Bio ...
-
bioRxiv - Cancer Biology 2021Quote: ... lentiviruses were concentrated using Lenti-X concentrator (Takara). 4T1 or MDA-MB-231 cells were transduced with concentrated viruses in the presence of 8 ug/ml of polybrene (Sigma ...
-
bioRxiv - Cancer Biology 2021Quote: ... Lentivirus was concentrated using Lenti-X Concentrator (Takara) and re-suspended in PDXO culture media supplemented with 10 μg/ml of polybrene (Sigma Aldrich) ...
-
bioRxiv - Immunology 2020Quote: Lenti-X HEK293T cells (Clontech, Mountain View, CA) were seeded at 2 million cells per 100 mm tissue culture dish and incubated for 48 hours at 37°C/5% CO2 in DMEM (Gibco ...
-
bioRxiv - Microbiology 2020Quote: ... concentrated overnight with a Lenti-X concentrator (Clontech) according to the manufacturer’s protocol.
-
bioRxiv - Immunology 2021Quote: ... envelope vector into Lenti-X 293T cells (Clontech) using Lipofectamine 2000 (Invitrogen) ...
-
bioRxiv - Immunology 2020Quote: Lenti-X 293T cells was purchased from Takara Biomedical Technology ...
-
bioRxiv - Immunology 2021Quote: Lenti-X HEK293T cells (Takara Bio cat 632180) were maintained in DMEM high glucose with GlutaMAX™ (Fisher Scientific cat 10566024) ...
-
bioRxiv - Neuroscience 2021Quote: ... and concentrated using Lenti-X concentrator (Takara Bio) following the manufacturer’s instructions.
-
bioRxiv - Cancer Biology 2020Quote: ... Lenti-X 293T cells were obtained from Takara and cultured in DMEM containing 10% FBS at 37°C in a humidified atmosphere containing 5% CO2 ...
-
bioRxiv - Immunology 2022Quote: ... All Lenti-X products were obtained from Takara-Clontech.