Labshake search
Citations for Takara Bio :
501 - 550 of 2288 citations for N 5 Trimethoxysilyl 2 Aza 1 Oxopentyl Caprolactam since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: A DNA matrix (Supplementary Table 5) was prepared with CloneAmp HiFi PCR Premix (Takara) using primer pair 56/60 (Supplementary Table 4 ...
-
bioRxiv - Biochemistry 2022Quote: ... A398P and T435P mutations (pDONR221-AR-AD-TAU-5) using KOD polymerase (Takara Bio) and the following primer pair.
-
bioRxiv - Microbiology 2023Quote: ... and 5 µl of the treated mix were used to transform competent bacteria (Takara, Stellar™ Competent Cells ...
-
bioRxiv - Developmental Biology 2024Quote: ... and 5 µl of SYBR® Premix-Ex-Taq (Tli RNase H Plus, Takara) in a 10 µl reaction ...
-
bioRxiv - Plant Biology 2024Quote: ... The CDS of effectors were cloned into pGBKT-7 vector (Clontech, USA, PT3248-5) with the sites EcoRI and BamHI ...
-
bioRxiv - Neuroscience 2024Quote: ... cDNAs were cloned using the SMARTer RACE 5’/3’ Kit (Takara, Cat No. 634858) and then sequenced (Beijing Genomics Institution ...
-
bioRxiv - Genetics 2022Quote: ... 1 μgml−1 doxcycline (TAKARA Bio) and 10−6 M dexamethasone (Sigma Aldrich).
-
bioRxiv - Molecular Biology 2023Quote: ... 1 µM Shield-1 (Takara # 632189) for 4 hours ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Its male-specific exon was amplified using Advantage® 2 Polymerase Mix (TaKaRa), the gene-specific primer “Cpun_dsx OD2 3’RACE” ...
-
bioRxiv - Microbiology 2021Quote: ... cDNA molecules were amplified using the Advantage 2 PCR kit (639206, Takara Bio) with initial denaturation at 95 °C for 1 min ...
-
bioRxiv - Microbiology 2020Quote: ... and 2 µl of lysate was used for PCR using SapphireAMP (Takara, RR350) and gene-specific primers ...
-
bioRxiv - Cell Biology 2021Quote: ... Primer sequences (Table 2) were verified using total human kidney RNA (Takara Bio). PSMB4 was determined as the most stable housekeeping gene using the method described by Xie ...
-
bioRxiv - Molecular Biology 2022Quote: ... cDNA was synthesized by adding 2 μl of PrimeScriptTM RT reagent kit (TaKaRa) to 500μg of RNA samples in 8 μl of distilled water (DW ...
-
bioRxiv - Cancer Biology 2024Quote: ... and 2 µl of lysate was used for PCR using SapphireAMP (Takara, RR350) and primers specific for each gene ...
-
bioRxiv - Developmental Biology 2023Quote: ... Quantitative real-time PCR was carried out using 2× TB-Green premix (TaKaRa) on a LightCycler-480®II (Roche) ...
-
bioRxiv - Cancer Biology 2023Quote: ... and either 2 μg of the Tet-On-3G transactivator (pLVX Tet3G, Clontech) or 2 μg of the pLenti-CMVtight-Hygro-DEST plasmid with each cDNA of interest ...
-
bioRxiv - Biochemistry 2023Quote: ... the supernatant was incubated for 2 hr with TALON metal affinity resin (Takara) pre-equilibrated with 50 mM Tris-HCl [pH 7.6] ...
-
bioRxiv - Genomics 2024Quote: ... 0.8 mM dNTP mix and 2 U Ex Taq polymerase (TaKaRa, Otsu, Japan). The thermal profile of the reaction started with initial stage 90 s at 94 °C which was followed by 30 cycles of 45 s denaturation at 94 °C ...
-
bioRxiv - Genomics 2024Quote: ... 1x Ex Taq buffer and 2 U Ex Taq polymerase (TaKaRa, Otsu, Japan). The thermal profile started with initial stage 94 °C for 3 min which was followed by 30 cycles of 1 min denaturation at 94 °C ...
-
bioRxiv - Genetics 2024Quote: ... and PCR was carried out using 2×Ex Taq Master Mix (TaKaRa CW0718). The PCR reaction was composed of 0.5 µg of template ...
-
bioRxiv - Developmental Biology 2024Quote: ... The cDNA library was prepared using an Advantage 2 PCR Kit (Clontech, 639206) and then sequenced via the Illumina sequencing platform (NovaSeq 6000) ...
-
bioRxiv - Genomics 2020Quote: ... 5 × 104 cells were stored at −80 °C in STEM CELLBANKER® (Takara Bio Inc.) until use ...
-
bioRxiv - Plant Biology 2020Quote: The 5’ Digoxigenin labeled R-box and non-labeled oligonucleotides were synthesized (Takara, Dalian, China). The binding mixture contained nuclear extracts ...
-
bioRxiv - Microbiology 2020Quote: ... single-stranded (ss) cDNA (sscDNA) was synthesized using the SMARTer RACE 5′/3′ Kit (Takara) with a U2-complementary primer ...
-
bioRxiv - Biophysics 2022Quote: ... This was then loaded onto a column with 5 ml His60 Ni-Superflow Resin (Clontech) previously equilibrated in the lysis buffer ...
-
bioRxiv - Molecular Biology 2022Quote: ... 4 μl of Ligation Mix (5 mM ATP, 7U Terminal Deoxynucleotidyl Transferase (TdT) (2230B, Takara), 15 U T4 RNA Ligase High Concentration (M0437 ...
-
bioRxiv - Microbiology 2021Quote: ... RNAs were probed with γ32P 5’ end-labeled oligonucleotide (Table S3) in ExpressHyb solution (Clontech) and scanned after exposition with Typhoon FLA 9500 scanner (GE Healthcare).
-
bioRxiv - Microbiology 2020Quote: ... The terminal sequences were recovered using a SMARTer® RACE 5’/3’ Kit (Takara, Japan) according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2020Quote: ... They were radiolabeled at their 5′ ends with [γ-32P] ATP by T4 polynucleotide (Takara) and purified using Oligo Clean & Concentrator (Zymo Research ...
-
bioRxiv - Zoology 2021Quote: ... The 3′-RACE assay was performed using the SMARTer RACE 5′/3′ Kit (CA94043, TaKara) following the manufacturer’s protocol ...
-
bioRxiv - Immunology 2024Quote: ... QPCR was then performed with a reaction mixture consisting of 5 μL SYBR Green (Takara), 0.2 μL Rox ...
-
bioRxiv - Cancer Biology 2024Quote: ... and Cla I sites 5′ to the BamH I site (Clontech, Mountain View, CA, USA).
-
bioRxiv - Molecular Biology 2023Quote: Rapid amplification of cDNA ends was performed using the SMARTerR RACE 5’/3’kit (Takara), us 1 μg of DNA-free RNA from zeocin-treated samples as template for first-strand cDNA synthesis according to manufacturer’s instructions ...
-
Human CCR6+ Th cells show both an extended stable gradient of Th17 activity and imprinted plasticitybioRxiv - Immunology 2023Quote: ... and CCR6high and transduced with lentivirus particles at an MOI of 5 using retronectin (TaKaRa) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... and the 5′-end was phosphorylated with T4 polynucleotide kinase (Cat. # 2021S: Takara, Kyoto, Japan). This phosphorylated DNA fragment was ligated to the Bbs I cloning site in pSpCas9(BB)-2A-Puro (PX459 ...
-
bioRxiv - Microbiology 2023Quote: ... Synthesized DNA was cloned into the pDON-5 Neo-vector (TaKaRa, Kusatsu, Japan, Cat# 3657), which was prelinearized with NotI-HF (New England Biolabs [NEB] ...
-
bioRxiv - Plant Biology 2024Quote: ... which was performed using a SMARTer RACE 5’/3’ Kit (Clontech Laboratories, Mountain View, CA) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2024Quote: 3’ and 5’RACE reactions were carried out using the SMARTer 3’5’ RACE kit (Takara), essentially as recommended by the manufacturer ...
-
bioRxiv - Bioengineering 2020Quote: ... were mixed at a 1:1:1 ratio and bound to retronectin (Clontech)-coated plates according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2023Quote: ... tubes with 1:1 FBS:PBS supplemented with recombinant RNase inhibitor (1:100, Takara). The live singlet gated CD3+ T cells were further gated as per the gating strategy shown in additional file 1 ...
-
bioRxiv - Molecular Biology 2020Quote: ... containing the beta-globin (HBB) 5’-UTR using the In-Fusion® HD Cloning Kit (Takara). The subsequent mutations in the TCRA and TCRB 3’-UTRs were generated using these initial constructs ...
-
bioRxiv - Cancer Biology 2020Quote: ... with 5 µg of pTetOne NTF2 (pDL66) and 100 ng of linear hygromycin marker (#631625, Clontech). After 4 hours at 37°C ...
-
bioRxiv - Biochemistry 2020Quote: ... The supernatants were applied to a chromatography column packed with 5 ml His60 superflow resin (Clontech) that had been equilibrated with buffer A (20 mM HEPES pH 7.5 ...
-
bioRxiv - Plant Biology 2020Quote: ... 5’ and 3’ RACE (rapid amplification of cDNA ends) were performed using the manufacturer’s instructions (Clontech).
-
bioRxiv - Molecular Biology 2020Quote: ... Antisense probes were radiolabeled at their 5′ ends with [γ-32P] ATP by T4 polynucleotide (Takara) and purified using Performa Spin Columns (Edge BioSystems) ...
-
bioRxiv - Immunology 2021Quote: ... using the modified (Switching Mechanism At 5’ End of RNA Transcript) PCR cDNA synthesis protocol (Clontech) and oligonucleotides as described below (Table S3) ...
-
bioRxiv - Immunology 2024Quote: ... The TCR sequences were then isolated using 5’RACE (SMARTer RACE cDNA Amplification Kit, Takara Bio), followed by PCR amplification with primers designed to be complementary to TRAC (GTTGCTCCAGGCAATGGCCCCATTGCTC ...
-
bioRxiv - Neuroscience 2023Quote: ... each pipette was filled with 3μl of pipette solution which consisted of 5% RNase inhibitor (Takara) in RNase-free PBS (Invitrogen ...
-
bioRxiv - Genomics 2023Quote: ... 5 µm-thick sections were cut and immunostained with anti-GFP antibody (living colors, Clontech, 632592) and secondary anti-rabbit IgG with Alexa fluor 488 (Thermo Fisher) ...
-
bioRxiv - Molecular Biology 2023Quote: ... The solution was treated with 5 μg/mL RNaseA and 70 unit/ml DNase I (Takara) for 1 h at 37°C ...