Labshake search
Citations for Takara Bio :
501 - 550 of 2043 citations for DOLICHOL FROM BOVINE HEART since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2024Quote: Total RNA was isolated from tissues harvested in TRIzol (Takara) as per manufacturer’s protocol ...
-
bioRxiv - Immunology 2024Quote: ... quantified using the AAVpro quantification kit (both from Takara Bio) and stored at –80°C.
-
bioRxiv - Molecular Biology 2024Quote: pUC19 purified by CsCl-EtBr ultracentrifugation was purchased from Takara-Bio ...
-
bioRxiv - Biochemistry 2024Quote: Plasmids from interaction candidates were extracted according the manual (Clontech). The selected prey candidates were sequenced and identified by comparison to the A ...
-
bioRxiv - Genetics 2024Quote: Total RNA was extracted from tissues using RNAiso Plus (Takara). The extracted RNA was quantified by Nanodrop and 500 ng of it was converted into cDNA using a PrimeScript™ RT reagent Kit (Takara) ...
-
bioRxiv - Cancer Biology 2024Quote: ... Four commercial samples (purchased from Ambion, Clontech and Takara companies) of pooled human brain (HB ...
-
bioRxiv - Cancer Biology 2024Quote: ... Four commercial samples (purchased from Ambion, Clontech and Takara companies) of pooled human brain (HB ...
-
bioRxiv - Systems Biology 2024Quote: ... Lenti-X™ 293T Cell Line was purchased from Takara Bio (632180) ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... for S100a9 with a primer set (MA058882) obtained from TaKaRa Bio Inc ...
-
bioRxiv - Cancer Biology 2024Quote: ... Tet-On inducible-homo-dimerization system was purchased from Clontech Laboratories Inc ...
-
bioRxiv - Cell Biology 2024Quote: ... Rat anti-E-cadherin mAb (ECCD-2, IB) from TaKaRa; Goat anti-LXR alpha + LXR beta pAb (ab24362 ...
-
bioRxiv - Biochemistry 2024Quote: ... GFP tagged Pol η was expressed from pEGFP-C1 (Clontech), that we firstly modified by addition of an SV40 nuclear localization signal (ATGCCAAAGAAGAAGCGAAAGGTA GCAGATCCA ...
-
bioRxiv - Cancer Biology 2024Quote: ... sgRNAs were PCR amplified from gDNA (Clontech, Takara, Cat#639242) and measured with deep sequencing on NovaSeq (Illumina).
-
bioRxiv - Cancer Biology 2024Quote: ... Lenti-X293T lenti-viral packaging cells were purchased from Takara Bio (# 632180) ...
-
bioRxiv - Cancer Biology 2024Quote: ... sgRNAs were PCR amplified from gDNA (Clontech, Takara, Cat#639242) and measured with deep sequencing on NovaSeq (Illumina).
-
bioRxiv - Cell Biology 2020Quote: The DNA constructs expressing EGFP- or mCherry-tubulin were from Takara Bio ...
-
bioRxiv - Cell Biology 2020Quote: ... the EGFP gene was excised from pEGFP-N1 (Takara Clontech, France) with flanking EcoRI/BsrGI sites and replaced with the mCherry gene ...
-
bioRxiv - Cell Biology 2020Quote: ... total RNA was extracted from cells using RNAiso (Takara Bio, USA) according to manufactures protocol ...
-
bioRxiv - Cell Biology 2020Quote: Mouse monoclonal E-cadherin antibody (HECD-1) was purchased from Takara Bio Inc ...
-
bioRxiv - Developmental Biology 2020Quote: Yeast media and plates were prepared according to recipes from Clontech and yeasts were grown at 30°C ...
-
bioRxiv - Molecular Biology 2020Quote: ... Reverse transcriptase kit and PrimeSTAR Max DNA Polymerase were from TaKaRa. RiboLock RNase Inhibitor and RNase A (10 mg/mL ...
-
bioRxiv - Molecular Biology 2020Quote: ... Viral supernatants were obtained from Lenti-X 293T cells (Clontech #632180) transfected with either pInducer21 GFP lentiviral vector or pInducer21 GFP constructs containing either p42 ...
-
bioRxiv - Biochemistry 2020Quote: ... CST was purified from the clarified lysate using Talon resin (Clontech) followed by protease cleavage of the GFP-His10 tag and finished with size exclusion chromatography on a Superdex 200 column equilibrated in Buffer A (25 mM HEPES pH 7.5 ...
-
bioRxiv - Genomics 2021Quote: Human brain total RNA was obtained from Takara (Cat No. 636530). The RNA was isolated by a modified guanidinium thiocyanate method and has RIN > 9.
-
bioRxiv - Plant Biology 2020Quote: ... Total RNA was extracted from seedling using RNAiso Plus (Takara, D9108B) for mRNA-seq ...
-
bioRxiv - Cell Biology 2020Quote: ... The dsRed monomer was amplified from the DsRed-Monomer Vector (Takara) using the primers dsR F and dsR R creating a 5’ XmaI site and a 3’ region homologous to the 5’ region of Rho1 ...
-
bioRxiv - Bioengineering 2021Quote: ... we pipetted 6 µL of 1x lysis buffer prepared from Clontech SMART-seq v4 kit with 2 U/µL RNAse inhibitor onto the coverslip ...
-
bioRxiv - Biochemistry 2020Quote: ... Clontech In-Fusion® Cloning Kit (638909) was purchased from Takara. All enzymes and buffers used in cloning were purchased from New England Biolabs.
-
bioRxiv - Neuroscience 2020Quote: ... Templates for assembly were derived from human whole-brain cDNA (Takara) for all cDNAs ...
-
bioRxiv - Cell Biology 2021Quote: ... The EGFP coding sequence was amplified from pEGFP-N1 vector (Clontech) with the following primers ...
-
bioRxiv - Cell Biology 2021Quote: The Lenti X 293T cell line (632180) was purchased from Takara Bio ...
-
bioRxiv - Plant Biology 2020Quote: Total RNA was isolated from indicated plants with RNAiso Plus (Takara). RNA was reverse transcribed (iScript™ cDNA Synthesis Kit ...
-
bioRxiv - Microbiology 2020Quote: ... RSV NC was expressed from a pEYFP-N1 containing vector (Clontech) described previously [9] ...
-
bioRxiv - Microbiology 2020Quote: ... DNA was removed from the isolated RNA using DNase I (Takara), and then cDNA was produced using M-MLV RT (Promega ...
-
bioRxiv - Cell Biology 2021Quote: ... Monoclonal mouse anti-GFP antibodies (JL-8) were from Clontech (632381). Monoclonal mouse anti-Flag (M2 ...
-
bioRxiv - Cell Biology 2021Quote: ... The mCherry coding region was amplified from the pmCherry-N1 (Clontech) plasmid using mCher-F/mCher-R primers and cloned into the pGT-GFPbsc plasmid at BglII/XhoI sites ...
-
bioRxiv - Microbiology 2022Quote: ... The In-fusion HD Cloning Plus kit was purchased from Takara Bio USA ...
-
bioRxiv - Developmental Biology 2022Quote: ... Predicted enhancer elements were PCR-amplified from mouse genomic DNA (Clontech) and cloned into the respective LacZ expression vector (Osterwalder et al ...
-
bioRxiv - Microbiology 2022Quote: ... and plasmid isolation and gel extraction kits were obtained from Takara Biotech (USA) ...
-
bioRxiv - Biophysics 2022Quote: ... The PCR reaction was done with CloneAmp Hifi premix from Takara.
-
bioRxiv - Biophysics 2022Quote: ... which was constructed from pCold I (Takara Bio Inc., Kusatsu, Japan) by replacing the sequences of the histidine tag and proteinase digestion site with that of pET-15b ...
-
bioRxiv - Microbiology 2021Quote: ... Total RNA was extracted from the collected cells with nucleospin (Takara). Numbers of RNA copies of the virus were determined by quantitative real-time PCR (SARS-CoV-2 Detection Kit ...
-
bioRxiv - Cancer Biology 2020Quote: ... HEK-LentiX cell line for lentivirus production was purchased from Takara Bio ...
-
bioRxiv - Neuroscience 2021Quote: ... Mir-X™ miRNA First Strand Synthesis Kit was from Takara Co. ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... SmartScribe RTase kit was acquired from Clontech (Mountain View, CA, USA). Phusion® High-Fidelity DNA Polymerase was from NEB (Beverly ...
-
bioRxiv - Cancer Biology 2022Quote: ... amplified from the linear puro marker (Cat. No. 631626, Takara-Bio), was inserted using the In-fusion HD cloning kit (Cat ...
-
bioRxiv - Cancer Biology 2022Quote: ... The Lenti-X™ 293T cell line was purchased from Takara-Bio (Cat ...
-
bioRxiv - Cancer Biology 2022Quote: U-2 OS Tet-On cells were purchased from Clontech (#630919). MDA-MB-453 cells were purchased from the American Type Culture Collection (ATCC ...
-
bioRxiv - Synthetic Biology 2020Quote: ... The pUC origin of replication was amplified from pmCherry-N1 (Clontech) using pUC_Lp and pUC_Rp (Table S2) ...
-
bioRxiv - Genetics 2020Quote: ... RNA was extracted from the worms using the standard TRIzol (Takara) method ...