Labshake search
Citations for Takara Bio :
5201 - 5250 of 5473 citations for Arg8 Vasopressin AVP ELISA Kit 5 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2024Quote: ... The PCR product was cloned into XhoI- and SalI-digested sites of pBluescript SK plasmid using an In-Fusion HD Cloning Kit (Takara Bio Inc.). Afterward ...
-
bioRxiv - Neuroscience 2024Quote: The samples were rRNA depleted and prepared for sequencing using SMARTer Stranded Total RNA Sample Prep Kit - HI Mammalian (Takara Bio, France). In brief ...
-
bioRxiv - Immunology 2024Quote: ... Complementary oligonucleotides with overhangs were annealed and cloned into the BbsI-digested U6b vector using a DNA ligation kit (Takara Bio, 6023). Sense strand:TTCGGAAGTGCCAATCATCACCTC ...
-
bioRxiv - Molecular Biology 2024Quote: Strand-specific RNA-seq was performed on parental and ibrutinib-resistant Rec-1 cells using SMARTer Stranded Total RNA Sample Prep Kit (Takara, cat# 634873) per the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: The purified product in ICDS method and captured beads in upgraded ICDS method were ready for Illumina library preparation with SMART ChIp-seq kit (Takara, Catalog # 634865) by following the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2024Quote: The purified product and captured beads in upgraded ICDS method were subjected to Illumina library preparation with SMART ChIp-seq kit (Takara, Catalog # 634865) by following the manufacturer’s protocol ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... The adjusted samples were subjected to real-time RT-PCR using the One Step SYBR RT-PCR Kit (Takara Corporation, Tokyo, Japan) and the PIKO REAL 96 Real-Time PCR System (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2024Quote: ... The rbp3 gene (slr0193) was amplified and ligated into vector pGEX-6P-1 using the In-Fusion Cloning kit (TaKaRa, Shiga, Japan) and the PCR primers pGEX-6P-1_inv-f/-r and Rbp3_iVEC-f/-r (SI Appendix ...
-
bioRxiv - Neuroscience 2024Quote: ... All expression plasmids were validated by Sanger DNA sequencing (Azenta Life Sciences) and prepared using Nucleobind Xtra Midi Endotoxin-free prep kits (Takara Cat # 740420.5), following the manufacturer’s protocol.
-
bioRxiv - Cell Biology 2024Quote: ... Constructs that express wrmScarlet-tagged V-ATPase components with gfp::unc-54 3’ UTR were generated using the In-Fusion Advantage PCR cloning kit (Clontech, Cat. #639621). The primers were listed in Extended Data Table 3.
-
bioRxiv - Developmental Biology 2021Quote: Full length human COG4 was cloned into pCS2+ vector from plasmid hCOG4-siR-3myc in AAZ6 (Gift from Professor Vladimir V. Lupashin) using In-Fusion® HD Cloning Kit (TaKaRa Bio, 638909) with primers 5’-ATGGGAACCAAGATGGCGGA-3’ ...
-
bioRxiv - Developmental Biology 2021Quote: TdT-mediated dUTP nick end labeling (TUNEL) staining was carried out with In Situ Apoptosis Detection Kit (MK500, Takara Bio Inc., Shiga, Japan), according to the manufacturer’s instruction ...
-
bioRxiv - Developmental Biology 2021Quote: TdT-mediated dUTP nick end labeling (TUNEL) staining was carried out with In Situ Apoptosis Detection Kit (MK500, Takara Bio Inc., Shiga, Japan), according to the manufacturer’s instruction ...
-
bioRxiv - Developmental Biology 2021Quote: ... Purified RNA served as input for the cDNA library preparation with SMART-Seq v.4 Ultra Low Input RNA kit (Takara Bio, Kusatsu, Japan) and Nextera XT DNA Library Prep Kit (Illumina ...
-
bioRxiv - Immunology 2021Quote: ... 100 μL cell culture supernatant was harvested for viral RNA extraction using the MINIBEST Viral RNA/DNA Extraction Kit (Takara, Cat no. 9766). RNA was eluted in 30 μL RNase-free water ...
-
bioRxiv - Genomics 2020Quote: ... All of the precipitated RNA was converted into a sequencing library using SMARTer® smRNA-Seq Kit for Illumina (Thermo Fisher/Takara 635032). The kit protocol was used with the following specifics ...
-
bioRxiv - Molecular Biology 2021Quote: ... RNA was subjected to rRNA depletion using a modified Ribozero method and library preparation using Clontech SMARTer Stranded RNA-Seq Kits (Takara Bio, Shiga, Japan). Sequencing was performed on the Illumina HiSeq2500 100bp PE Rapid run (Ramaciotti Centre for Genomics ...
-
bioRxiv - Genomics 2020Quote: Round 1 PCR amplicons were collected from the ICELL8 chip using the SMARTer ICELL8 Collection Kit: (Collection Fixture, Collection Tube and Collection Film) into a collection and storage tube as per manufacturer’s instructions (Takara Bio USA, CA, USA). 50% of the extracted library was purified twice using a 1X proportion of AMPure XP beads (Beckman Coulter ...
-
bioRxiv - Genomics 2020Quote: RNA preparations of similar quality from adult mouse testis and sperm were used for constructing PacBio IsoSeq libraries (SMRT bell libraries). Full-length cDNA was synthesized using the Clontech SMARTer PCR cDNA Synthesis kit (Cat. # 634925) (Clontech, Palo Alto, CA). Approximately 13-15 PCR cycles were required to generate 10-15 µg of ds-cDNA from a 1 µg RNA sample ...
-
bioRxiv - Molecular Biology 2021Quote: ... were co-transfected into HEK293T cells at a 1:1:1:1.6:4.6 ratio using CalPhos mammalian transfection kit (TaKaRa Clontech, Mountain View, CA #631312) according to manufacturer’s instructions ...
-
bioRxiv - Genetics 2019Quote: First strand cDNA was synthesized from 1 μg total RNA by using a PrimeScript RT Reagent Kit with gDNA Eraser (Takara Bio, Kusatsu, Japan). qRT-PCR was performed in a 25 μl reaction volume with SYBR Premix Ex Taq II Tli RNaseH Plus (Takara Bio ...
-
bioRxiv - Genomics 2020Quote: ... Full-length cDNA libraries were constructed from 1 μg of total RNA with SMARTer® cDNA synthesis kit (Takara Bio, Kusatsu, Shiga Japan), utilizing switching mechanism at 5’ end of RNA template (SMART ...
-
bioRxiv - Microbiology 2019Quote: ... The DNA fragment was introduced to the pKNTG plasmid KpnI and HindIII sites via In-Fusion-HD cloning kit (Takara Bio USA, Inc). We sequenced plasmids and transformed into the ΔFvgbb2 and WT strain resulting in ΔFvgbb2-Gbb2-GFP and FvGbb2-GFP strain ...
-
bioRxiv - Molecular Biology 2019Quote: ... the 5’- and 3’- rapid amplification of cDNA end (RACE) were performed according to the manufacturer’s protocol of the SMART RACE cDNA Amplification kit (Clontech, Mountain View, California, USA). The gene-specific primers are described in Table S8 (1st PCR ...
-
bioRxiv - Plant Biology 2019Quote: RNA was reverse-transcribed and amplified using the SMART-Seq v4 Ultra Low Input RNA Kit for Sequencing (Clontech, Mountain View, CA, USA) 21 ...
-
bioRxiv - Immunology 2021Quote: ... or RARα403 (RARα-dAF2) 41 with a C-terminal Halo-tag were generated using the In- Fusion Cloning Kit (TaKaRa Bio Inc, Shiga, Japan). Lentiviruses were generated using CSII-EF- MCS-IRES2-Venus (for overexpression) ...
-
bioRxiv - Immunology 2021Quote: ... cDNA was synthesized and amplified using template switching technology of the SMART-Seq v4 Ultra Low Input RNA Kit (Clontech Laboratories, Cat. #R400752), followed by purification using the Agencourt AMPure XP Kit (Beckman Coulter ...
-
bioRxiv - Plant Biology 2020Quote: ... Then the first-strand cDNA synthesis was primed with an oligo (dT) primer by using a PrimeScript™ RT reagent Kit with gDNA Eraser (Perfect Real Time) (Takara, Dalian, China) according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2020Quote: ... a 4.0 kb fragment containing the ERF019 gene and its native promoter was amplified and inserted into pBI101 with BamHI and SacI by In-Fusion HD Cloning Kit (Takara Bio, Shiga, Japan). For awf2 ...
-
bioRxiv - Cancer Biology 2020Quote: ... Amplified cDNA from the ICELL8® 3’ DE Chip individual cells was collected and pooled using the ICELL8® Collection Kit (Takara Bio) by centrifugation at 3,200 x g ...
-
bioRxiv - Cancer Biology 2020Quote: ... and used to produce low input Illumina Fragment libraries using a Low Input Library Prep kit v2 (Clontech Laboratories, Inc., Catalog No. 634899). DNA was fragmented using the Covaris S220 sonic disruptor and libraries were then sequenced as paired end reads with a read length of 100bp on an Illumina HiSeq 3000.
-
bioRxiv - Plant Biology 2020Quote: ... First-strand cDNA was synthesized from 1 μg total RNA (20 μL reaction volume) using a PrimeScript™ 1st Strand cDNA Synthesis Kit (Takara, Dalian, China) according to the manufacturer’s protocol.
-
bioRxiv - Cell Biology 2021Quote: ... pChlamiRNA3int (obtained from the Chlamydomonas Resource Center) in between Xho1 and Not1 restriction sites by In-fusion HD EcoDry cloning plus kit (Takara, Cat. No. 638915). A gene fragment encoding three copies of the 9-amino-acid HA epitope followed by EcoR1 and XbaI restriction sites was inserted using QuikChange II XL Site-Directed Mutagenesis Kit (Agilent technologies) ...
-
bioRxiv - Cell Biology 2021Quote: ... For iPSC-O differentiation to hepatocyte-like cells (HLC-O): Hepatic differentiation of iPSC-O was performed by Cellartis Hepatocyte Differentiation Kit (Y30050, Takara Bio, Shiga, Japan) according to the manufacturer’s instructions ...
-
bioRxiv - Systems Biology 2021Quote: ... 6 genes were generated as inserts in the shuttle vector puC57 and were subsequently cloned into pDM323 between BglII and SpeI sites using the In-Fusion® HD Cloning Kit (Takara Bio USA) and confirmed by sequencing ...
-
bioRxiv - Microbiology 2021Quote: ... The LAMP1 gene was then sub cloned into the pEF1α-mCherry-N1 vector using the In-Fusion® HD Cloning Kit (Clontech, Takara, Japan), according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: pEX18Tc-hpdA was constructed for gene knockout by fusing the erythromycin resistance gene and two upstream and downstream fragments of the target gene amplified with the primers shown in Table 3 to Sac I/Hind III-digested pEX18Tc with the In-Fusion® HD Cloning Kit (TaKaRa, Dalian, China). The resulting plasmid pEX18Tc-hpdA was transformed into E ...
-
bioRxiv - Microbiology 2020Quote: ... The amplification of viral DNA by PCR was carried out base on the manufacturer’s recommendations of the LA PCR Kit (TaKaRa Biomedical Technology Beijing, China). Briefly ...
-
bioRxiv - Microbiology 2020Quote: The lentivirus-based expression plasmids were generated with a pLOV-CMV-GFP vector (Neuron Biotech, China) using In-Fusion HD Cloning kits (Clontech Laboratories, Inc., USA), according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: ... or its derivatives with appropriate antibiotics resistant genes (ampicillin for Escherichia coli and neomycin or puromycin for mammalian cells) and a tag (SNAP-tag or HaloTag) using an In-Fusion HD Cloning Kit (639635, Takara Bio, Shiga, Japan). The E ...
-
bioRxiv - Neuroscience 2022Quote: ... Antennal cDNA was synthesized from 1 μg of antennal total RNA using SMARTer™ RACE cDNA amplification kit according to manufacturer’s instructions (Clontech, Mountain View, CA). To obtain full-length coding sequences ...
-
bioRxiv - Cancer Biology 2022Quote: ... 0.25 ng to 10 ng of total RNA was used for cDNA library preparation using a kit suitable for RNA isolation at pico-molar concentrations (MARTer Stranded Total RNA-Seq Kit v2-Pico Input Mammalian) following manufacturer recommended protocol (Clontech/Takara Bio #635005). Sequencing was performed by the UM DNA Sequencing Core ...
-
bioRxiv - Microbiology 2022Quote: The BLV pol gene was measured in the genomic DNA samples of blood and tissue samples of cattle using real-time PCR with a BLV Detection Kit (Takara Bio, Otsu, Japan) with a LightCycler 480 System II (Roche Diagnostics ...
-
bioRxiv - Developmental Biology 2020Quote: ... The corresponding full-length cDNA library was then generated using 1μg total RNA and the SMARTer PCR cDNA synthesis kit (Clontech, Takara Bio Inc., Shiga, Japan) following PacBio recommendations set out in the Iso-Seq method ...
-
bioRxiv - Molecular Biology 2021Quote: ... The chip was then loaded again on Fluidigm C1 and cDNA was synthesised and pre- amplified in the chip using Clontech SMARTer kit (Takara Clontech, Cat# 634833). In batch B ...
-
bioRxiv - Neuroscience 2020Quote: mRNA in the cell lysate was reverse-transcribed and amplified for 25 cycles using the SMART-Seq v4 Ultra Low Input kit for Sequencing (Takara Bio USA #634893) according to manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2020Quote: ... The PCR products of the expected size were purified using the Easy Pure Quick Gel Extraction Kit (Transgen Biotech, Beijing, China) and cloned into TA Vector (Takara Biotechnology, Dalian, China). Positive clones were selected and sequenced by Beijing Genomics Institute (Beijing ...
-
bioRxiv - Microbiology 2020Quote: ... One hundred microliter cell culture supernatant was harvested for viral RNA extraction using the MiniBEST Viral RNA/DNA Extraction Kit (Takara, Cat no. 9766) according to the manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2022Quote: ... Reverse transcription to obtain cDNA was performed according to the instructions of the PrimeScript 1st Strand cDNA Synthesis Kit (Takara Biomedical Technology (Beijing) Co. ...
-
bioRxiv - Microbiology 2022Quote: ... The PCR product was ligated into the NotI site of the pNEN142 vector (Minetoki et al., 2003) with an In-Fusion HD Cloning Kit (Takara Bio, Kusatsu, Japan); this vector contains the improved promoter of the A ...