Labshake search
Citations for Takara Bio :
4951 - 5000 of 5356 citations for Pig Glucagon Like Peptide 2 GLP 2 CLIA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Evolutionary Biology 2021Quote: ... The Rdl PCR-product was subcloned into the transcription vector pTB-207 38 using the In-Fusion® HD Cloning Kit (Clontech™) and cRNAs were synthesized with the T7 mMessage mMachine kit (Ambion™) ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: Site-directed mutagenesis in GC-A and GC-B and construction of chimeric receptors were performed through use of the In-Fusion HD plus cloning kit (Takara Bio Inc.). The primers used are listed in Supplementary Table 1 ...
-
bioRxiv - Developmental Biology 2020Quote: ... Hmx1 putative enhancer elements were amplified by PCR from total genomic DNA using the LA Taq PCR kit v2.1 (TaKaRa, Mountain View, CA) and the following primers ...
-
bioRxiv - Cancer Biology 2020Quote: ... Purified RNA samples were reverse-transcribed into cDNA using the PrimeScript™ RT Reagent Kit with gDNA Eraser (RR047A, TaKaRa, Tokyo, Japan).
-
bioRxiv - Cancer Biology 2021Quote: ... according to instructions provided by the manufacturer and 2μg aliquots were reversed transcribed cDNAs using PrimeScript™ RT-PCR Kit (Takara, Dalian, China). After ...
-
bioRxiv - Immunology 2020Quote: ... Viral particle counts were determined by sodium dodecyl sulfate disruption and spectrophotometry at 260 and 280 nm and viral titers were determined using the Adeno-X™ Rapid Titer Kit (Takara Bio). The constructs created included:
-
bioRxiv - Microbiology 2020Quote: ... the target genes with or without glycosite mutation were cloned into the pTOR::FLAG vector using the In-fusion HD Cloning kit (Clontech, Beijing, China) (Table S1) ...
-
bioRxiv - Microbiology 2019Quote: ... and the first strand of cDNA synthesis was performed using the PrimeScript™ RT reagent Kit with gDNA Eraser (Takara, Dalian, China). All quantitative PCR were performed in triplicate on an ABI 7500 Fast real-time PCR system (Applied Biosystems ...
-
bioRxiv - Immunology 2020Quote: ... the reverse transcription (RT) reaction was performed in a two-step method following the PrimeScript™ II Reverse Transcriptase kit protocol (Takara, Japan). For the first step ...
-
bioRxiv - Immunology 2021Quote: ... TM cells were directly sorted into 1X lysis buffer and cDNA was synthesized and amplified directly from intact cells using SMART-Seq v4 Ultra Low Input RNA Kit for Sequencing (Takara Bio USA) according to the manufacturer protocol ...
-
bioRxiv - Immunology 2021Quote: ... SMART-Seq v4 Ultra Low Input Kit for Sequencing was used for full-length cDNA synthesis and amplification (Clontech, Mountain View, CA), and Illumina Nextera XT library was used for sequencing library preparation ...
-
bioRxiv - Genomics 2021Quote: Paired-end RNA-seq libraries were constructed from >747 pg of RNA using the SMART-Seq v4 ULTRA Low Input RNA Kit for Sequencing (Takara, cat. 634891) and NexteraXT kits (Illumina ...
-
bioRxiv - Neuroscience 2021Quote: ... encoding murine preproSST transgene fused with GFP via T2A self-cleavage spacer sequence was prepared by AAVpro purification kit (TaKaRa Bio, Japan) and bilaterally injected into PFC (AP +1.9 mm ...
-
bioRxiv - Bioengineering 2020Quote: ... cDNA was synthesized using a mix of random hexamers – oligo d(T) primers and PrimerScript reverse transcriptase enzyme (Takara bio inc. Kit), again following the manufacturer’s instructions ...
-
Rac1, Rac3 GTPases and TPC2 are required for axonal outgrowth and migration of cortical interneuronsbioRxiv - Neuroscience 2022Quote: ... Total RNA was subjected to reverse transcription according to the protocol of Prime Script 1st Strand cDNA Synthesis kit (Takara Bio USA). Real time PCR analysis was performed using a Step One Plus real-time PCR system (Applied Biosystems ...
-
bioRxiv - Developmental Biology 2022Quote: 1 µg of tissue specific (ovary) RNA was used for First strand cDNA synthesis using PrimeScriptTM 1st strand cDNA Synthesis Kit (Takara, Cat# 6110A) using the following program ...
-
bioRxiv - Molecular Biology 2022Quote: ... the plasmids were cleaved using restriction enzymes and purified using electrophoresis and NucleoSpin Gel & PCR Clean-up kit (Takara bio, Shiga, Japan). The copy number of each standard DNA was calculated based on the concentration quantified with the Qubit 3 Fluorometer (Thermo Fisher Scientific ...
-
bioRxiv - Biochemistry 2022Quote: ... the RNAs of 150µl of the supernatant were extracted and quantified using Retro-X™ qRT-PCR Titration Kit (Takara, cat# 631453), according to the manufacturer instruction.
-
bioRxiv - Bioengineering 2022Quote: ... All the fragments were ligated sequentially and inserted into XhoI site on pABpaR2pX by In-Fusion HD Cloning Kit (Clontech Laboratories, Inc.) To generate the transfer vector for NA9-Bac ...
-
bioRxiv - Cell Biology 2022Quote: ... 5 ng of total RNA was amplified and converted to cDNA using the SMART-Seq v4 Ultra Low Input RNA kit (Clontech Ref. 634889). Afterwards ...
-
bioRxiv - Cell Biology 2022Quote: ... cDNA were amplified from the embryo RNA using PrimeScript™ II High Fidelity One Step RT-polymerase chain reaction (PCR) Kit (Takara, R026A) using the following primers ...
-
bioRxiv - Immunology 2022Quote: ... TCR α- and β-chain genes were reverse transcribed and amplified from the RNA using the SMARTer RACE Kit (Clontech Laboratories, Inc). The amplified TCR genes were sub-cloned into the pEF- 1α/pENTR vector (Addgene ...
-
bioRxiv - Genomics 2022Quote: We prepared stranded RNA-Seq libraries for each plasma fraction using Clontech SMARTer stranded total RNA-seq kit v2-pico input mammalian (Takara Bio, 634414) according to the manufacturer’s instructions ...
-
bioRxiv - Genetics 2022Quote: ... was reverse-transcribed into the first-strand cDNA in a 20 μl reaction volume using the first strand cDNA synthesis Kit (TaKaRa, Dalian, China). PCR amplification were 94℃ for 3 min ...
-
bioRxiv - Plant Biology 2022Quote: Full-length CDSs of CiS40-11 was cloned into the expression vector pCanG-HA and pCAMBIA1302 using In-Fusion® HD Cloning Kit (TaKaRa, Japan). All generated binary plasmids were confirmed by enzyme digestion and sequencing validation ...
-
bioRxiv - Molecular Biology 2022Quote: ... was purchased from Eurofins Genomics and inserted in the C-termini of GFP with the In-Fusion HD cloning kit (Takara Bio USA). All primers used for the plasmid construction are listed in Table 3.
-
bioRxiv - Microbiology 2022Quote: ... These PCR products were then assembled and cloned into a plasmid pAPT110 linearized with NheI using the In-Fusion® HD cloning kit (Takara Bio) to generate plasmid p4G39 ...
-
bioRxiv - Microbiology 2022Quote: ... all RNA preparations were subjected to a second DNase treatment using the genomic DNA (gDNA) Eraser (Perfect Real Time Kit, Takara Biochemicals, China). RNA concentrations were quantified on a Nanodrop 2000 spectrophotometer (Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2022Quote: ... 10 ng RNA were used and 7 PCR cycles were carried out to synthesise cDNA with the SMART-Seq® v4 Ultra® Low Input RNA Kit (cat # 634891, Takara). RNAseq libraries were prepared with the Nextera XT DNA Library Preparation Kit (cat# FC-131–1096 ...
-
bioRxiv - Microbiology 2022Quote: ... The Apollo 324 NGS Library Prep System was used with the PrepX RNA-seq library preparation kit (Takara Bio, San Jose, CA). Sequencing was performed on Illumina NovaSeq 6000 platform (SP 100nt Lane ...
-
bioRxiv - Microbiology 2022Quote: ... The resulting probe reaction mixtures were electrophoresed on a 0.8% agarose gel for 30 min at 100 V and then gel purified with a NucleoSpin Gel and PCR Clean-up kit (Takara Bio USA). The EMSA binding reaction ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: Total RNA was extracted from the whole bodies of a pool of 15 AM-treated larvae using the TaKaRa MiniBEST Universal RNA Extraction Kit (TaKaRa, Dalian, China) following the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2022Quote: ... cDNAs were synthesized using 3 µg each of the total RNA and PrimeScript 1st strand cDNA synthesis kit (Takara, Kusatsu, Shiga, Japan). Exon spanning primes were made ...
-
bioRxiv - Physiology 2022Quote: ... samples were rRNA depleted utilizing the RiboGone Mammalian-Low Input Ribosomal RNA Removal Kit (Takara Bio USA Inc., Mountain View, CA, USA), and Agencourt AMPure XP SPRI beads (Beckman Coulter) ...
-
bioRxiv - Physiology 2023Quote: ... cDNA was made from 100-400 ng of DNase-treated total RNA using a Takara PrimeScript RT Reagent Kit with gDNA Eraser (Takara bio RR047B). Quantitative PCR was performed using TB Green™ Premix Ex Taq™ (Tli RNaseH Plus ...
-
bioRxiv - Immunology 2022Quote: Matched healthy donor RNA was used to generate targeted IgG and IgM AIRR-seq libraries using the SMARTer Human BCR IgG IgM H/K/L Profiling Kit (Takara Bio USA) according to the manufacturer’s instructions with no modifications ...
-
bioRxiv - Immunology 2022Quote: Extracted RNA was thawed on ice and converted to first strand complementary DNA (cDNA) using the SMARTer RACE 5’/3’ Kit (Takara Bio USA), as described by the manufacturer and a custom oligonucleotide that contained the template switch oligo and a unique molecular identifier (5’ TSO-UMI ...
-
bioRxiv - Synthetic Biology 2022Quote: ... and inputted into cDNA synthesis by incubation with a mixture of random hexamers and reverse transcriptase (TAKARA PrimeScript RT Reagent Kit with gDNA Eraser, Takara Bio #RR047A). The resulting cDNA was diluted 1:10 and 2 μl of each sample was amplified using a QuantStudio 5 (Applied Biosystems ...
-
bioRxiv - Molecular Biology 2022Quote: ... qPCR was performed using a One-Step SYBR Green Prime ScriptTM RT-PCR Kit II (Perfect Real Time, Clontech, Takara, Kyoto, Japan) with a Thermal Cycler Dice™ system (Takara ...
-
bioRxiv - Molecular Biology 2022Quote: ... qPCR was performed using a One-Step SYBR Green Prime ScriptTM RT-PCR Kit II (Perfect Real Time, Clontech, Takara, Kyoto, Japan) with a Thermal Cycler Dice™ system (Takara ...
-
bioRxiv - Molecular Biology 2022Quote: ... and libraries were prepared with a SMART-Seq Stranded Kit according to the user manual (Takara Bio USA, Mountain View, CA, USA). In brief ...
-
bioRxiv - Plant Biology 2023Quote: ... The resulting fragments were cloned into vector backbones derived from pPY22 (mNeonGreen-Hygromycin B) or pPY23 (mNeonGreen-Nourseothricin) using the In-Fusion Snap Assembly Kit (Takara, cat. 638948). For PpREN knockout ...
-
bioRxiv - Cell Biology 2024Quote: ... SMART-Seq v4 Ultra Low Input Kit for Sequencing was used for full-length cDNA synthesis and amplification (Clontech, Mountain View, CA), and Illumina Nextera XT library was used for sequencing library preparation ...
-
bioRxiv - Molecular Biology 2024Quote: ... The RNA extracted from the gonads underwent reverse transcription after concentration adjustment with the PrimeScript™ RT reagent Kit with gDNA Eraser (Perfect Real Time) (Takara, Japan).
-
bioRxiv - Molecular Biology 2024Quote: ... Total RNA prepared from adult mouse livers was reverse-transcribed using a PrimeScript II first-strand cDNA Synthesis Kit (Takara, Shiga, Japan) with a random hexamer primer ...
-
bioRxiv - Molecular Biology 2024Quote: The full length BRD4 DNA fragment was amplified by PCR from pcDNA4-TO-HA-BRD4FL (Addgene plasmid #31351)61 incorporated into linearized FM5 lentiviral vectors containing standardized linkers (generously provided by David Sanders) using the In-Fusion HD cloning kit (Takara Bio, 638910). BRD4dN-mCh-sspB (Addgene plasmid #121968)31 and NLS-iLID-Ferritin (Addgene plasmid #122147)40 were originally developed and characterized in previous Brangwynne lab studies ...
-
bioRxiv - Genetics 2024Quote: ... GFP-fused Actb WT and S348L in pcDNA3-GFP were amplified using KOD One (TOYOBO, Osaka, Japan) and cloned into pCSf107mT[31] using the In-Fusion HD Cloning Kit (Takara, Shiga, Japan) resulting in pCSf107mT-GFP-Actb WT and S348L ...
-
bioRxiv - Molecular Biology 2024Quote: ... forward = TTTCTAAGACTCTCTCCCGTA and reverse = GATTAGAAGTAGCCGACCAA) was labeled with dCTP [α-32P] using Random Primer DNA Labeling Kit Ver.2.0 (Takara, catalog #6045). The hybridization was done at 65°C overnight in Church and Gilbert Moderate Hybridization Buffer (1% BSA ...
-
bioRxiv - Neuroscience 2023Quote: ... cDNA with mutations or deletion were constructed by site-directed mutagenesis using PrimeSTAR® HS DNA Polymerase mutagenesis kit (Takara Bio, Japan) following to the manufacturer’s instructions.
-
bioRxiv - Molecular Biology 2024Quote: ... PCR products were analysed by gel electrophoresis and positive products were purified using the NucleoSpin Gel and PCR clean up kit (Clontech, Takara Bio) before being sent for sequencing by Eurofins Genomics (Germany) ...