Labshake search
Citations for Takara Bio :
451 - 500 of 649 citations for tert Butyl 10 oxo 4 9 diazaspiro 4.5 decane 4 carboxylate since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... Samples were incubated 30 min at RT and loaded onto a 10 μL aliquot of Talon (Takara) resin ...
-
bioRxiv - Immunology 2021Quote: ... Viral supernatants were collected after 48h and loaded onto retronectin-coated (10 ug mL−1, Takara Bio) non-TC 24-well plates ...
-
bioRxiv - Immunology 2023Quote: ... RNA extracted and amplified (10 ng RNA/sample) using SMART-Seq® HT kit (Takara Bio, #634455) according to the manufacture’s instruction ...
-
bioRxiv - Immunology 2023Quote: ... RNA extracted and amplified (10 ng RNA/sample) using SMART-Seq® HT kit (Takara Bio, #634455) according to the manufacture’s instruction ...
-
bioRxiv - Microbiology 2023Quote: ... 500 ng of total RNA was then reverse transcribed in 10 µL reactions using PrimeScript RT (TAKARA) and random hexamer primers ...
-
bioRxiv - Neuroscience 2023Quote: ... Total RNA was heat denatured and digested with 10-20 U of MazF enzyme (TakaRa, ref. 2415A) for 15 min at 37°C ...
-
bioRxiv - Cell Biology 2022Quote: ... 2019) and 10 fmol JF646-LANA (see below) in 0.5 nL phosphate-buffered saline (PBS, Takara, T900) containing 0.05% phenol red (SIGMA ...
-
bioRxiv - Synthetic Biology 2024Quote: ... The resin was washed twice by incubating it with 1 mL equilibration buffer for 10 minutes (Takara), centrifuging the resin (700xg for 5 minutes ...
-
bioRxiv - Biophysics 2024Quote: Cells were grown in DMEM culture media (Thermo-Fisher) supplemented with 10% tetracycline-free FBS (Clontech, 631106), 1% sodium pyruvate (NaPy ...
-
bioRxiv - Bioengineering 2024Quote: ... a new 24-well non-treated tissue culture plate was coated with 10 µg retronectin (Takara, T100A) in 1 ml PBS per well ...
-
bioRxiv - Genetics 2024Quote: ... Viral supernatant was harvested after 48 hours and concentrated 1:10 using the Lenti-X concentrator (Takara). Concentrated supernatant was resuspended in PBS and stored at -80°C ...
-
bioRxiv - Plant Biology 2020Quote: ... 10 AtCBLs prey vectors were co-transformed into the yeast strain AH109 following manufacturer’s instructions (Clontech, CA, USA). The empty vectors pTOOL27 and pTOOL28 were also co-transformed into yeast with each prey or bait plasmid respectively to confirm that bait does not autonomously activate the reporter genes in the absence of the prey protein.
-
bioRxiv - Genetics 2021Quote: ... followed by a final extension at 72 °C for 10 min by using Takara Taq polymerase (Clontech, #TAKR001). To remove the DsRed cassette ...
-
bioRxiv - Biophysics 2021Quote: ... and sgRNA were cultured at 37°C and 5% CO2 in high-glucose Dulbecco’s modified Eagle’s medium (DMEM, HyClone) supplemented with 10% (v/v) FBS (ClonTech), 250 µg/ml hygromycin ...
-
bioRxiv - Microbiology 2021Quote: ... 10 μg of Spike expressor and 2 μg of a green fluorescent protein (GFP) expressor (pIRES2-eGFP; Clontech) was transfected into 2 × 106 293T cells ...
-
bioRxiv - Neuroscience 2020Quote: ... cDNA of Human Phosphodiesterase type 10 (hPDE10) was amplified by conventional nested PCR using human brain cDNA (Clontech). cDNAs template encoding wild-type and D674A mutant form of hPDE10 catalytic domain (CD ...
-
bioRxiv - Cell Biology 2020Quote: ... The 10 amino acid duplication 3’ to GFP or mCherry2 on SHH protein was introduced using Infusion (Clontech) using primers (forward 5’TCCGGCGGCAGATCTGCAGAGAACTCCGTGGCGGCCAAATCCGGCGGCTGTTTCCCGG GA and reverse 5’ tcccgggaaacagccgccggatttggccgccacggagttctctgcagatctgccgccgga) ...
-
bioRxiv - Biophysics 2021Quote: ... A total of 20 μl reaction system contains 10 μl 2X Premix Ex Taq II (TaKaRa, Dalian, China), 1 μl of 3D gene specific primer (forward ...
-
bioRxiv - Systems Biology 2022Quote: ... and deposited in 10 uL ice-cold lysis buffer containing 0.1% Triton-X 100 and RNase inhibitor (Takara) and stored at −80°C until further processing ...
-
bioRxiv - Neuroscience 2020Quote: ... We coated 6-8 mg of 1.6 µm gold beads with 10-15 µg of EGFP-N1 (Clontech) or 20 μg pSuper-cofilin1-shRNA + 20 μg pSuper-ADF-shRNA (Bosch et al. ...
-
bioRxiv - Plant Biology 2021Quote: ... The transcript abundance was measured in 10 µL volume of the SYBR Green PCR Master Mix (Takara, Japan) containing cDNA corresponding to 5 ng of total RNA with gene-specific primers ...
-
bioRxiv - Microbiology 2021Quote: ... 500 ng of total RNA was used in 10 μL PrimeScript™ RT Master Mix (TaKaRa, Tokyo, Japan) as described in the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... column was equilibrated with 10 column volumes of Equilibration Buffer (HisTALON™ Buffer Set, Clontech Laboratories, Cat# 635651). The filtered supernatant was loaded onto the HisTALON cartridge (Clontech Laboratories ...
-
bioRxiv - Cell Biology 2023Quote: ... and used for library preparation (5-10 ng) using SMART-Seq v4 Ultra Low Input RNA Kit (Clontech). Libraries were sequenced on Novaseq platform (Illumina).
-
bioRxiv - Neuroscience 2022Quote: ... 4 uL Maxima 5x RT buffer, 0.124 uL NxGen RNAse inhibitor, 0.25 uL SUPERase In, 1 uL 10 mM Takara dNTPs ...
-
bioRxiv - Biophysics 2022Quote: ... 10 μL of the reaction was then transformed into 100 μL of StellarTM competent cells (Takara Bio USA) and plated on kanamycin plates ...
-
bioRxiv - Genetics 2022Quote: ... 0.1-0.2*106 mESCs were seeded per well in a 24-12-well plate in conventional ESC medium and transduced the next day with 0.25-0.5 ml of 10:1 concentrated (lenti-X, Clontech) supernatant with 8 ng/μl polybrene (Sigma Aldrich) ...
-
bioRxiv - Microbiology 2022Quote: ... 10 µg of Spike expressor and 2.5 µg of a green fluorescent protein (GFP) expressor (pIRES2-eGFP; Clontech) was transfected into 2 × 106 HEK 293T cells ...
-
bioRxiv - Neuroscience 2023Quote: All cells were cultured in high glucose DMEM with 10% Fetal Bovine Serum (tetracycline free, Clontech or Gibco) and penicillin/streptomycin 50units/ml-50 mg/ml ...
-
bioRxiv - Bioengineering 2023Quote: ... Samples were incubated at 42 °C for 10 min with gDNA Eraser to remove the genomic DNA (Takara). PrimeScript RT Reagent Kit was used for RNA reverse transcription and cDNA synthesis ...
-
bioRxiv - Genetics 2024Quote: ... The reaction was performed in a 20 μL reaction mixtures comprising 10 μL of 2× SYBR (TaKaRa, Japan), 1 μL of cDNA ...
-
bioRxiv - Cancer Biology 2024Quote: ... T cells were transduced using lentivirus at an MOI between 5 and 10 on Retronectin-coated (Takara, T100B) plates overnight to express an M5 or SS1 CAR ...
-
bioRxiv - Neuroscience 2024Quote: Genomic DNA was extracted from 10 whole bodies of wandering flies using MightyPrep reagent for DNA (Takara #9182). Whole body RNA was extracted from 10 whole bodies of wandering flies using TRIzol (Ambion #15596018) ...
-
bioRxiv - Molecular Biology 2024Quote: ... 5 µL of the eluate was digested overnight at 37°C with 10 units of DpnI (Takara, 1235A) in a final volume of 10 µL ...
-
bioRxiv - Neuroscience 2024Quote: ... DNA was transfected into nearly confluent (80-90%) 10 cm2 plates of low-passage LentiX 293T (Takara #632180) using a calcium phosphate transfection protocol ...
-
Targeted degradation of PCNA outperforms stoichiometric inhibition to result in programed cell deathbioRxiv - Cell Biology 2022Quote: Human embryonic kidney T-REx 293 cells which express the tetracycline repressor protein were purchased from Thermo Fisher Scientific and cultured in Eagle’s Minimum Essential Medium (MEM) GlutaMAX™ supplemented with 10% Tet system approved FBS (Clontech) and 5 μg/mL blasticidin ...
-
bioRxiv - Developmental Biology 2022Quote: ... https://www.addgene.org/112849/)10 between the EcoRI and SpeI restriction sites by multi-cassette assembly using the InFusion cloning kit (Takara Inc.). The correct sequence of the donor region was validated by Sanger sequencing.
-
bioRxiv - Molecular Biology 2021Quote: 20 cm plates of HEK293T cells were transfected with 10 µg of each plasmid using CalPhos transfection kit (Takara) according to manufacturer’s instructions and harvested 3 days later ...
-
bioRxiv - Molecular Biology 2020Quote: ... where each well contained 20 μL of reaction mixture consisting of: 10 μL SYBR Premix Ex Taq II (TaKaRa), 0.4 μL ROX Reference Dye (50× ...
-
bioRxiv - Genomics 2021Quote: ... and then resuspended in 10 mM TAPS pH8.5 containing 1X DAPI and 1X secondary diluent reagent (Takara Cat# 640196) at a concentration of 400 nuclei/µL ...
-
bioRxiv - Molecular Biology 2021Quote: DIE cells were cultured in growth medium consisting of IMDM basal medium with 10% Tet system-approved FBS (Clontech) and 55μM 2-mercaptoethanol ...
-
bioRxiv - Cancer Biology 2020Quote: ... full-length Bcor cDNA or truncated BcorΔE9-10 cDNA was cloned with an N-terminal HA tag into pCAG vector using InFusion (Takara). pCMV-SPORT 6.1 with mouse Bcl6 cDNA was purchased from Horizon Discovery (Clone ID 6309948).
-
bioRxiv - Neuroscience 2021Quote: ... 10 μM ROCK inhibitor (Y-27632; Selleckchem, Cat. No. S1049) and 2 μg/mL doxycycline (Clontech, Cat. No. 631311). Media was changed daily during this stage.
-
bioRxiv - Molecular Biology 2021Quote: ... the pellet was re-suspended in four millilitres of filtered-sterilized (0.22 µm filter) lysing buffer (75 mg/mL BSA; 10 mg/mL Yatalase (Takara); 5 mg/mL Lysing Enzymes (L1412 Sigma) ...
-
bioRxiv - Immunology 2021Quote: ... bone marrow was harvested and transduced with SINV virus on plates coated with 10 μg/cm2 Retronectin (T100, Takara) for 1.5-2 hrs at 650×g and 37°C ...
-
bioRxiv - Cell Biology 2022Quote: ... Reverse transcription was performed with 10 ng RNA using the SMART-Seq v4 Ultra Low Input RNA Kit (Takara) according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... the nine pmW118 plasmid vectors were subjected to amplification of the cDNA fragments (F1-F9-10) of SARS-CoV-2 XBB.1 and XBB.1.5 by PrimeSTAR GXL DNA polymerase (Takara) with the primer sets24 ...
-
bioRxiv - Neuroscience 2023Quote: ... GP2-293 cells were cultured in DMEM (FUJIFILM Wako Pure Chemical) supplemented with 10% tetracycline-free FBS (Takara Bio).
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... Supernatant containing virus was collected 48 h later and 10-X concentrated using Lenti-X Concentrator (Takara Bio, Germany). AML-12 wild-type cells were transduced using concentrated virus and selected using 3 μg/mL of puromycin ...
-
bioRxiv - Cell Biology 2024Quote: ... 1×105 cells of HeLa cells or BJ-5ta cells expressing inducible TM-mNG21-10 were transfected with 7.5 pmol of Cas9 (TAKARA), 7.5 pmol of sgRNA ...