Labshake search
Citations for Takara Bio :
451 - 500 of 2206 citations for 5 Chloro 1 vinyl 2 pyridone since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2020Quote: ... 5’ and 3’ RACE (rapid amplification of cDNA ends) were performed using the manufacturer’s instructions (Clontech).
-
bioRxiv - Molecular Biology 2020Quote: ... Antisense probes were radiolabeled at their 5′ ends with [γ-32P] ATP by T4 polynucleotide (Takara) and purified using Performa Spin Columns (Edge BioSystems) ...
-
bioRxiv - Immunology 2021Quote: ... using the modified (Switching Mechanism At 5’ End of RNA Transcript) PCR cDNA synthesis protocol (Clontech) and oligonucleotides as described below (Table S3) ...
-
bioRxiv - Neuroscience 2023Quote: ... each pipette was filled with 3μl of pipette solution which consisted of 5% RNase inhibitor (Takara) in RNase-free PBS (Invitrogen ...
-
bioRxiv - Cell Biology 2023Quote: ... and 5 µg RNA was reverse transcribed into cDNA using a cDNA synthesis kit (Takara Bio) as per the manufacturer’s instructions ...
-
bioRxiv - Genomics 2023Quote: ... 5 µm-thick sections were cut and immunostained with anti-GFP antibody (living colors, Clontech, 632592) and secondary anti-rabbit IgG with Alexa fluor 488 (Thermo Fisher) ...
-
bioRxiv - Immunology 2024Quote: ... The TCR sequences were then isolated using 5’RACE (SMARTer RACE cDNA Amplification Kit, Takara Bio), followed by PCR amplification with primers designed to be complementary to TRAC (GTTGCTCCAGGCAATGGCCCCATTGCTC ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... and deposited into a PCR tube with 5 μL lysis buffer (Takara Bio, San Francisco, CA). cDNAs were then prepared by reverse transcriptase (Takara Bio ...
-
bioRxiv - Molecular Biology 2023Quote: ... The solution was treated with 5 μg/mL RNaseA and 70 unit/ml DNase I (Takara) for 1 h at 37°C ...
-
bioRxiv - Plant Biology 2024Quote: ... The obtained cDNA was subjected to 5’ RACE-PCR using SeqAmp DNA Polymerase (Takara Bio USA). Primers used for 5’ RACE-PCR and the number of PCR cycles are shown in Supplemental Table 3 ...
-
bioRxiv - Biochemistry 2024Quote: ... the supernatant was loaded onto a 5 ml column of TALON® Metal Affinity Resin (TAKARA) equilibrated with Buffer A ...
-
bioRxiv - Neuroscience 2020Quote: ... TetO/NGN2 gene expression was induced by Doxycycline (2 μg/mL; Clontech, Madison, WI) on day 0 ...
-
bioRxiv - Immunology 2022Quote: ... 2 μl of the pre-RT-PCR2 (PrimeScript™ II Reverse Transcriptase, Takara Bio) mix was added to each well ...
-
bioRxiv - Plant Biology 2021Quote: ... The Yeastmaker Yeast Transformation System 2 was used according to the manufacturer’s instructions (Clontech). pGBK-53 and pGADT were used as positive controls ...
-
bioRxiv - Biochemistry 2022Quote: ... cDNA was produced from 2 mg overall RNA with AMV reversed transcriptive enzyme (TaKaRa) as per the supplier’s instruction ...
-
bioRxiv - Plant Biology 2021Quote: ... and c-DNA was prepared using 2 µg total RNA samples (Takara Bio, UK). The c-DNA samples were diluted ten times and an aliquot of 2 µl of each sample per reaction was used for qRT-PCR ...
-
bioRxiv - Plant Biology 2021Quote: ... Transformants were selected on Synthetic Defined (SD) medium lacking Leu and Trp (−2) (Clontech). Three individual transformants were grown overnight in liquid SD (−2 ...
-
bioRxiv - Plant Biology 2021Quote: ... Reactions were performed by mixing 2 μL 5x In-Fusion HD enzyme mix (Clontech), 100 ng of linearized vector ...
-
bioRxiv - Microbiology 2020Quote: ... The 20 μl reaction mixture contained 10 μl 2×TB green Premix DimerEraser (Takara), 1 μl of each primer ...
-
bioRxiv - Microbiology 2020Quote: ... specific primer sets for SARS-CoV-2 and PrimeSTAR GXL DNA polymerase (TaKaRa Bio). The 5’ termini of RNA were amplified by using the 5’RACE System for Rapid Amplification of cDNA Ends ...
-
bioRxiv - Biochemistry 2021Quote: ... wt and mutants was induced by treatment with 2 μg/ml Doxycycline (631311, Clontech) for 24-48 hours ...
-
bioRxiv - Cell Biology 2020Quote: ... Reverse transcription was performed using PrimeScript RT Master Mix (CD201-2, TaKaRa, Otsu, Japan), and qPCR was performed using SYBR Premix Ex Taq II (RR820L ...
-
bioRxiv - Immunology 2021Quote: ... The RNA of the SARS-CoV-2 was extracted for reverse transcription (TAKARA, Japan). The SARS-CoV-2 was quantitative analyzed with real time PCR by targeting S protein.
-
bioRxiv - Molecular Biology 2023Quote: ... 10 μL of TB Green Premix Ex Taq 2 (TliRNaseH Plus) (Takara, Beijing, China), 0.8 μL of 10 μM bidirectional primers (Table 1) ...
-
bioRxiv - Bioengineering 2023Quote: ... 37°C for 2 hours in a plate coated with Retronectin (Takara Bio, T100B) with an MOI of ∼5.0 for each lentivirus (dCas9 lentivirus at MOI ∼5.0 and gRNA-MCP-fusion effector lentivirus) ...
-
bioRxiv - Neuroscience 2022Quote: ... The titer of AAVs was measured by using AAVproR titration kit ver.2 (Takara).
-
bioRxiv - Cancer Biology 2022Quote: ... 2 µg of plasmids were diluted in 200 µL Xfect transfection reagent (631317, Takara). The mixture was incubated at room temperature for 15 min ...
-
bioRxiv - Molecular Biology 2022Quote: ... 10 μL of TB Green Premix Ex Taq 2 (TliRNaseH Plus; Takara, Dalian, China), 0.8 μL of each primer (Table 1) ...
-
bioRxiv - Cell Biology 2022Quote: ... and the supernatant was incubated with 2 mL TALON Metal Affinity Resin (Takara Bio) for 1 h at 4 °C with rotation ...
-
bioRxiv - Microbiology 2023Quote: ... followed by RT-PCR using PrimeScript One Step RT-PCR Kit Ver.2 (TaKaRa) with primers no ...
-
bioRxiv - Genomics 2024Quote: ... the first PCR was performed using a Multiplex PCR Assay Kit Ver.2 (Takara) with MIG-seq primer set-1 developed by Suyama and Matsuki (2015) ...
-
bioRxiv - Cancer Biology 2024Quote: ... 2 ml of medium fresh lentivirus media generated using pLVX-Tet-On Advanced (ClonTech) with 8 ug/ml polybrene (Thermo Fisher ...
-
bioRxiv - Cell Biology 2024Quote: ... 2 (TOYOBO, Osaka, Japan) or the In-Fusion cloning kit (Clontech, Mountain View, CA). To generate pCSIIpuro-Necl5-ScNeo ...
-
bioRxiv - Cell Biology 2023Quote: ... E-cadherin antibody (HECD-1, 1:1000 IF, 1:1000 WB) was from Takara Bio ...
-
bioRxiv - Neuroscience 2023Quote: ... rabbit anti-DsRed (1:200-1:500, Clontech), mouse anti-1D4 anti-Fasciclin II (1:10 ...
-
bioRxiv - Molecular Biology 2024Quote: ... doxycycline (DOX, 1 µg ml−1, Takara Bio) and 2% penicillin–streptomycin (Gibco) ...
-
bioRxiv - Cancer Biology 2022Quote: ... pre-cleared by centrifugation at 1000xg for 5 min and concentrated by 40X using Lenti-X (Takara) following the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2020Quote: ... cDNA was synthesized from 5 ng of total RNA using the PrimeScript Reverse Transcriptase (Takara by Clontech) and a mix of random hexamers - oligo dT primer ...
-
bioRxiv - Cancer Biology 2020Quote: ... cDNA was synthesized from 5 ng of total RNA using the PrimeScript Reverse Transcriptase (Takara by Clontech) and a mix of random hexamers - oligo dT primer ...
-
bioRxiv - Developmental Biology 2022Quote: ... PGCs and EGCs were lysed at room temperature for 5 minutes in lysis buffer (Takara Bio, #635013) containing RNAse inhibitors (Takara Bio ...
-
bioRxiv - Cell Biology 2022Quote: ... and 5 units of SMART Moloney murine leukemia virus reverse transcriptase (Takara Bio, Mountain View, CA, USA). The RT reaction was carried out at 42°C for 2 hrs ...
-
bioRxiv - Bioengineering 2020Quote: The cleared lysate was poured on 5 mL packed Ni-NTA agarose (His60 Superflow, TaKaRa Bio Europe) gravity flow columns ...
-
bioRxiv - Pathology 2020Quote: ... and 5 units of SMART Moloney murine leukemia virus reverse transcriptase (Takara Bio, Mountain View, CA, USA). The RT reaction was carried out at 42°C for 2 hrs ...
-
bioRxiv - Molecular Biology 2023Quote: ... For quantitative RT-PCR 1ug of total RNA was treated with 5 Units of DNase I (Takara) and cDNA synthesized with SuperScriptIII (Life Technologies ...
-
bioRxiv - Microbiology 2023Quote: ... We next cloned the synthesized DNA into the pDON-5 Neo-vector (TaKaRa, Kusatsu, Japan, Cat# 3657), which was pre-linearized with NotI-HF (New England Biolabs [NEB] ...
-
bioRxiv - Molecular Biology 2024Quote: ... or 5 ng of total RNA (with a SMARTer Stranded Total RNA-Seq Kit v3; Takara Bio) was used.
-
bioRxiv - Cell Biology 2023Quote: ... pseudonana (PtPyShell1, TpPyShell1, and TpPyShell2) were determined by RACE using a SMARTer RACE 5’/3’ kit (TaKaRa). Sequences were amplified by PCR and cloned into pPha-T1 or pTha-NR vectors containing a fragment of enhanced GFP by a seamless ligation cloning extract method (Motohashi ...
-
Comprehensive mutational analysis of the checkpoint signaling function of Rpa1/Ssb1 in fission yeastbioRxiv - Genetics 2023Quote: ... the supernatant was loaded onto a 5 ml column with prewashed Talon resin (Clontech Laboratories, Inc, CA). The column was washed three times with the low pH buffer (pH 6.3) ...
-
bioRxiv - Microbiology 2024Quote: Sequencing of variable heavy and kappa chains was obtained using SMARTer 5’ RACE technology (Takara Bio USA) adapted for immunoglobulins to amplify the variable genes from the heavy and kappa chains ...
-
bioRxiv - Molecular Biology 2024Quote: ... while amplicons over 5 kb were produced using PrimeStar GXL polymerase (Takara Bio, San Jose, CA, #R050A) in a two-step amplification reaction ...