Labshake search
Citations for Takara Bio :
701 - 750 of 2206 citations for 5 Chloro 1 vinyl 2 pyridone since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2024Quote: ... were designed using Primer3Plus (https://www.primer3plus.com/) and sequence accuracy was confirmed by SMARTer RACE 5’/3’ Kit (TaKaRa, Kusatsu, Japan) according to the manufacturer’s instruction ...
-
bioRxiv - Molecular Biology 2024Quote: ... was amplified from 0.5 µl (5 ng) of a gene fragment in 20 µl using 2X CloneAmp HiFi PCR Premix (Takara Bio) with 250 nM of each primer TAATACGACTCACTATAGGCAATCCGCCCTCACTACAACCG and TCCCTCATCGACGCCAGAGTAG ...
-
bioRxiv - Immunology 2024Quote: ... The individual 25 µl volume 5’RACE PCR reactions were then carried out in 96-well plates using the thermocycler program recommended by the 5’RACE kit (Takara), with 35 cycles of gene-specific amplification with an annealing temperature of 60°C ...
-
bioRxiv - Developmental Biology 2024Quote: ... BAC DNA or hL1-5’_3.3kb plasmids were purified using the NucleoBond® Xtra Midi Plus EF kit (Takara # 740422.50) following instructions for low-copy or high-copy plasmids ...
-
bioRxiv - Cell Biology 2020Quote: ... SLD3 and ESA1 ORF were PCR-amplified with Taq polymerase (MightyAmp ver. 2, Takara Bio Co., Otsu, Japan) and cloned into the BamHI sites of the Y2H DB vector pST1667 and the Y2H AD vector pST548 (Tanaka ...
-
bioRxiv - Cell Biology 2020Quote: ... transformed with pGEX-4T-2-Bbs5-WT in the presence of 0.1 mM isopropyl-β-D-thiogalactopyranoside (Takara). The proteins were purified with the glutathione-Sepharose 4B protein chromatography purification kit (GE Healthcare) ...
-
bioRxiv - Cancer Biology 2020Quote: Freshly harvested sorted LT-HSCs were starved in PBS for 2 hours and then fixed onto RetroNectin (Clontech)-coated slides ...
-
bioRxiv - Microbiology 2021Quote: ... 10 μg of Spike expressor and 2 μg of a green fluorescent protein (GFP) expressor (pIRES2-eGFP; Clontech) was transfected into 2 × 106 293T cells ...
-
bioRxiv - Neuroscience 2020Quote: ... cell content was ejected onto 1.1 µl drop of lysis buffer (0.1% Triton X-100, 2 U/µl TaKaRa RNAse inhibitor ...
-
bioRxiv - Cell Biology 2021Quote: ... 2 µg of total RNA was subsequently reverse transcribed to cDNA using PrimeScript RT Master Mix (Takara Bio) according to the manufacturer’s protocol ...
-
bioRxiv - Physiology 2022Quote: ... cDNA was synthesized using 2 μg RNA using the PrimeScript™ RT reagent Kit with gDNA Eraser (TaKaRa). Gene specific primers for quantitative real-time PCR (qRT-PCR ...
-
bioRxiv - Plant Biology 2021Quote: ... 2 μg of RNA was reverse transcribed in a 20 μL volume with RT PCR master mix (TaKaRa) as per the manual instruction ...
-
bioRxiv - Microbiology 2020Quote: ... RT-qPCR was then performed using gene-specific primers (Table 2) and TB Green Premix Ex Taq (Takara). Levels of gene expression were normalized to that of 16S rRNA and expression was assessed for each biofilm and each timepoint relative to its planktonic counterpart using the 2−ΔΔCt method (43).
-
bioRxiv - Evolutionary Biology 2022Quote: ... Yeast 2-hybrid library screening was conducted using the Matchmaker Gold Yeast Two-Hybrid System (Takara Bio USA) according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2022Quote: Purified total RNA was reverse transcribed into cDNA by PrimeScript™ 2 1st strand cDNA Synthesis Kit (TaKaRa). The target gene fragments (Brachyury ...
-
bioRxiv - Microbiology 2020Quote: ... The qPCR reaction system consisted of 12.5 μL of 2 × SYBR Premix Ex TaqTM II (Takara, Dalian, China), 0.5 μL of upstream and downstream primers (10 mM) ...
-
bioRxiv - Plant Biology 2021Quote: ... URA3: GAL1UAS–Gal1TATA–LacZ MEL1) via the Yeastmaker™ Yeast Transformation System 2 kit (Clontech, Mountain View, USA). An agarose gel image of the cDNA library is shown in Fig ...
-
bioRxiv - Genomics 2021Quote: ... Long range PCR was performed using Advantage 2 Polymerase following the manufacturer’s protocol (Clontech Laboratories, Mountain View CA).
-
bioRxiv - Animal Behavior and Cognition 2021Quote: ... The 2-μg RNA sample was reverse transcribed using the PrimeScript™ RT Master Mix (Takara, Shiga, Japan). Quantitative real-time PCR (qPCR ...
-
bioRxiv - Molecular Biology 2020Quote: ... cDNA was amplified by PCR in separate 25 μL reactions each containing 2 μL of cDNA for typically 7-9 cycles using 0.5 μL (2.5 u) LA Taq (Takara) with P5-3’ and miRCat-PCR-2 oligos (IDT ...
-
bioRxiv - Microbiology 2023Quote: HEp-2 cells were transduced with supernatants of Plat-GP cells cotransfected with pMDG60 and pRetroX-Tet3G (TaKaRa), selected with 4 mg/ml G418 (Wako) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Specific primers were designed for this purpose and PCR was done using the Advantage 2 Polymerase kit (Clontech). Complementary 60 bp-ends to each target sequence on all Mycoplasmas species genome used in this study ...
-
bioRxiv - Cell Biology 2023Quote: ... cultures were split into two 2-ml cultures of which one was supplemented with 250 nM rapalog (Clontech). Mislocalisation of the target protein was verified by live-cell microscopy.
-
bioRxiv - Cell Biology 2023Quote: ... The virus titer was quantified using the AAVpro Titration Kit (for Real Time PCR) Ver.2 (Takara Bio) according to the manufacturer’s instructions.
-
bioRxiv - Genetics 2023Quote: ... electrophoresis was performed using 9 μL of the PCR products on a 2% agarose gel (Takara Bio, Japan) at 100 V ...
-
bioRxiv - Neuroscience 2023Quote: ... the cell body was immediately sucked into the glass electrode with negative pressure and expelled onto a 1.1 µl drop of the ice-cold lysis buffer (0.1% Triton X-100, 2 U/µl TaKaRa RNAse inhibitor ...
-
bioRxiv - Cell Biology 2023Quote: ... and N-SREBP2 (1440 bps) were amplified using high-fidelity PCR (Advantage-HF 2 PCR kit, #639123; Clontech) from human pcDNA3.1-2xFLAG-SREBP1a (#26801 ...
-
bioRxiv - Genetics 2024Quote: ... The reaction was performed in a 20 μL reaction mixtures comprising 10 μL of 2× SYBR (TaKaRa, Japan), 1 μL of cDNA ...
-
bioRxiv - Genetics 2024Quote: ... Yeast transformation was carried out using the Yeastmaker™ Yeast Transformation System 2 (Takara Bio Inc., cat. # 630439).
-
bioRxiv - Developmental Biology 2024Quote: ... Total RNA (2 μg) was reverse-transcribed into cDNA with random hexamers using the PrimeScript II reagent (TaKaRa). Human cDNA was purchased from Clontech ...
-
bioRxiv - Microbiology 2024Quote: ... The viral RNA copy number was standardized using a SARS-CoV-2 direct detection RT-qPCR kit (Takara). Fluorescent signals from resulting PCR products were acquired using a Thermal Cycler Dice Real Time System III (Takara).
-
bioRxiv - Immunology 2024Quote: ... In-fusion assembly with the 2 fragments was performed using the In-fusion snap assembly kit by Takara Bio.
-
bioRxiv - Plant Biology 2024Quote: ... benthamiana leaves at 2 days post-agroinfiltration (dpa) using the PrimeScript RT Reagent Kit (Perfect Real Time, Takara) according to manufacturer’s instructions ...
-
bioRxiv - Genetics 2024Quote: The fusion PCR reaction system (50 μl) consisted of 25 μl of 2 PrimeSTARMax Premix (TaKaRa, Dalian, China), 3 μl of 10 mM sgRNA-F ...
-
bioRxiv - Biochemistry 2022Quote: ... TEX12 (1-123) and SIX6OS1 (1-587) were cloned into pGADT7 vectors (Clontech). The Matchmaker™ Gold system (Clontech ...
-
bioRxiv - Molecular Biology 2020Quote: ... The plug was equilibrated twice in 1 ml of 1× M buffer (TaKaRa) by rotating the tube for 30 min at room temperature ...
-
bioRxiv - Neuroscience 2020Quote: ... then in 1:25,000 or 1:100,000 rabbit anti DSRed (Takara Bio USA) in 10% NHS-TPBS ...
-
bioRxiv - Physiology 2024Quote: ... (Cx43: 1:3000 custom-produced rabbit polyclonal; eGFP: 1:1000 mouse monoclonal (Clontech Laboratories Inc ...
-
bioRxiv - Molecular Biology 2024Quote: ... The plug was equilibrated twice in 1 mL of 1× M buffer (TaKaRa) by rotating the tube for 30 min at room temperature ...
-
bioRxiv - Molecular Biology 2024Quote: ... The plug was equilibrated twice in 1 mL of 1× M buffer (TaKaRa) by rotating the tube for 30 min at room temperature ...
-
bioRxiv - Microbiology 2022Quote: ... and 50 ng mL−1 or 25 ng mL−1 anhydrotetracycline (aTc, Clontech) and Aeromonas sp ...
-
bioRxiv - Molecular Biology 2021Quote: ... were co-transfected into HEK293T cells at a 1:1:1:1.6:4.6 ratio using CalPhos mammalian transfection kit (TaKaRa Clontech, Mountain View, CA #631312) according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... and a linker sequence (5’-GGTAGCGGCAGCGGTAGC-3’) were added through three additional PCR reactions using PrimeStar GXL DNA polymerase (Takara Bio). PCR products were gel-purified in each step ...
-
bioRxiv - Molecular Biology 2021Quote: ... for at least 20 min, followed by 5 ug/cm2 of laminin (Fisher, CB40232) resuspended in basal RHB-A medium (Takara, Y40000). After washing off this treatment ...
-
bioRxiv - Molecular Biology 2021Quote: ... The mixtures were prewarmed at 37°C for 5 min and digested samples were treated with 66.6 U/mL (final conc.) MNase enzyme (Takara Bio, #2910A) at 37°C for 30 min ...
-
bioRxiv - Developmental Biology 2020Quote: ... subsequently placed in a line in the electrode gap filled with 5 μl the mixture of 120 ng/μl Cas9 protein (TaKaRa, Japan), 300 ng/μl tracerRNA ...
-
bioRxiv - Molecular Biology 2021Quote: ... The resulting cDNA was diluted 5-20 fold and analyzed by real-time qPCR using the SYBR Green master mix (Takara bio) and 400 nanomolar each of the following primers ...
-
bioRxiv - Genomics 2020Quote: ... Transcripts rising from the identified TSS were determined using the SMARTer Rapid amplification of cDNA ends (RACE) 5’/3’ kit (Takara Bio) in accordance with the manufacturer’s instructions for 3’ RACE ...
-
bioRxiv - Immunology 2021Quote: ... the isolated RNAs were subjected to first-strand cDNA synthesis using (5’-GTCGTATCCAGTGCAGGGTCCGAGGTCACTG GATACGACATACAACA-3’) by PrimeScriptTM II 1st Strand cDNA Synthesis Kit (Takara, Japan). After that ...
-
bioRxiv - Genomics 2020Quote: ... the ORFs of all KRAB-transposase fusions except for KRABINER were synthesized as gBlocks (IDT) with 15bp of homology on the 5’/3’ end to facilitate In-Fusion cloning (Clontech, #638920) into either the pcDNA3.1+ (Addgene #V790-20 ...