Labshake search
Citations for Lonza :
401 - 450 of 1259 citations for 8 chloro 10 3 dimethylamino propyl phenothiazin 1 ol since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2020Quote: ... dissociated into single cell suspension with trypsin-EDTA (Pan-Biotech, Germany) for 3 min followed by trypsin neutralizing solution (Lonza, Germany). Single cell suspensions of secondary mammospheres were obtained as described for day 7-first generation mammospheres.
-
bioRxiv - Immunology 2022Quote: ... were transfected with 0.1 nmol of siRNA oligonucleotides (listed in Supplementary Table 3) using a Human Monocyte Nucleofactor Kit (Lonza, VVPA-1007) and the AMAXA Nucleofector System (Lonza ...
-
bioRxiv - Developmental Biology 2019Quote: ... 4 μg of the donor ssDNA and 3 μg of a puromycin resistance plasmid (pCAG-puroR) using the Mouse ES Cell Nucleofector™ Kit (Lonza) following the manufacturer’s protocol ...
-
bioRxiv - Immunology 2020Quote: ... Slices were immediately placed in a 6-well plate containing 3 mL per well of “complete RPMI”: RPMI (Lonza, 16-167F) supplemented with 10 % FBS (VWR ...
-
bioRxiv - Molecular Biology 2024Quote: ... All cell lines were confirmed to be mycoplasma negative every 3 weeks (MycoAlert™ Mycoplasma Detection Kit, Lonza, Bend, OR, USA). Fifteen micrograms of total whole cell lysates (WCL ...
-
bioRxiv - Genetics 2023Quote: ... The RNP complex together with 7 µg of donor DNA was nucleofected into 3 × 107 ISE6 cells using EN150 and buffer SF via the 4D-Nucleofector system (Lonza Bioscience) (Figure S1) ...
-
bioRxiv - Bioengineering 2024Quote: ... Cells were cultured at passage 3 and seeded in triplicate in hMSC Growth Medium (MSCGM™ Mesenchymal Stem Cell Growth Medium, Lonza) with 10% FBS ...
-
bioRxiv - Immunology 2024Quote: ... were transfected with 0.1 nmol of siRNA oligonucleotides (listed in Extended Data Table 3) using a Human Monocyte Nucleofactor Kit (Lonza, VVPA-1007) and the AMAXA Nucleofector System (Lonza ...
-
bioRxiv - Cancer Biology 2019Quote: ... and 10% FBS (HyClone) and routinely tested for mycoplasma contamination using MycoAlert (Lonza).
-
bioRxiv - Microbiology 2020Quote: ... 10 µl of schizonts was mixed with 100 µl of P3 solution (Lonza) containing 30 µg each of the relevant donor and guide vectors ...
-
bioRxiv - Microbiology 2021Quote: ... transferred to a 96 well plate and washed with HBSS (Lonza # 10-527F) with 0.1% BSA ...
-
bioRxiv - Bioengineering 2020Quote: ... Human NK-92 cells (ATCC) were propagated in X-VIVO 10 medium (Lonza) supplemented with 8% heat-inactivated human plasma (German Red Cross Blood Donation Service Baden-Württemberg–Hessen ...
-
bioRxiv - Molecular Biology 2021Quote: ... the cells were washed with 10 ml of ice-cold 1x PBS (Lonza) twice ...
-
bioRxiv - Developmental Biology 2022Quote: ... per 10 cm dish with EGM-2MV (Cat# CC-3156,CC-4147, Lonza) media supplementation ...
-
bioRxiv - Cancer Biology 2022Quote: ... and the pelleted cells were incubated in ACK lysis buffer (Lonza, 10-548E) for 3 minutes at RT ...
-
bioRxiv - Neuroscience 2022Quote: ... at a concentration of 10 × 106 cells/petri dish in RPMI1640 medium (Lonza) supplemented with 10% fetal calf serum (FCS ...
-
bioRxiv - Microbiology 2023Quote: ... transferred to a 96 well plate and washed with HBSS (Lonza # 10-527F) with 0.1% BSA ...
-
bioRxiv - Developmental Biology 2023Quote: ... per 10 cm dish with EGM-2MV (Cat# CC-3156,CC-4147, Lonza) media supplementation ...
-
bioRxiv - Molecular Biology 2024Quote: ... and received biweekly medium exchanges of serum free XVIVO-10 medium (Lonza #(BE) BP04-743Q ...
-
bioRxiv - Systems Biology 2023Quote: ... 5% CO2 in 1:1 RPMI:MEGM (Lonza, #CC-3151), 3% fetal bovine serum (FBS,Gibco) ...
-
bioRxiv - Bioengineering 2023Quote: ... engineered GVs at OD500 = 3.6 were mixed 1:1 with 1% w/v agarose (Lonza, #50070) in MOPS buffer with 400 µM CaCl2 or 10 mM EGTA (final OD500 = 1.8 ...
-
bioRxiv - Developmental Biology 2021Quote: ... and 5 µg of PX459 gRNA vector (5’-GACTCCAGTCTTTCTAGAAGA-3’) were nucleofected with the AMAXA Mouse Embryonic Stem Cell Nucleofector Kit (LONZA, VPH-100) using program A-30 in the XRep ...
-
bioRxiv - Developmental Biology 2021Quote: ... 4 μg of the donor ssDNA and 3 μg of a puromycin resistance plasmid (pCAG-puroR) using the Mouse ES Cell Nucleofector™ Kit (Lonza, Switzerland) following the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2022Quote: ... Cell lines are cultivated at 37°C with 5% CO2 and were tested every 3 months for mycoplasma contamination using Universal Mycoplasma detection kit (ATCC, 30-1012K) or MycoAlert Plus Mycoplasma Detection Ki (Lonza, LT07-701). Cell lines were used no more than 30 passages.
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... A high resistance Plastiape® RS00 inhaler (Plastiape S.p.A, Osnago, Italy) containing size #3 HPMC capsules (V-Caps® Plus, Lonza, Morristown, NJ) and 1-3 mg of powder was attached to a USP induction port by a molded silicon adapter ...
-
bioRxiv - Immunology 2020Quote: ... Transfection of primary T cells with Cas9 RNP complexes and TCRβα HDR templates was performed 3-4 days following activation using the 4D-Nucleofector and a 20 uL format P3 Primary Cell kit (Lonza, V4XP-3032). Briefly ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... were seeded onto 96-well plates at a density of 3×104 cells per well in 100 μL cell culture media that consisted of DMEM (Lonza, Basel, Switzerland), 1% penicillin–streptomycin (Lonza ...
-
bioRxiv - Microbiology 2023Quote: ... Full-thickness samples were obtained by 12 mm punch and placed in 12-well plates containing 3 mL Dulbecco’s Modified Eagle Medium (DMEM) (Lonza, Walkersville, MD, USA) supplemented with 10% fetal bovine serum (FBS ...
-
bioRxiv - Biochemistry 2023Quote: ... Cells were regularly passaged 2-3 times a week and routinely tested for mycoplasma contamination using MycoAlert Plus mycoplasma Detection kit (Lonza, #LT07-710).
-
bioRxiv - Genomics 2024Quote: ... and electroporated with 6 μg of gRNA-Cas9 expression vector and 3 μg of SNRPN targeting vector using the P3 Primary Cell 4D-Nucleofector Kit (Lonza, V4XP-3032). Transfected cells were plated into a 10 cm dish coated with Matrigel (Corning ...
-
bioRxiv - Genomics 2019Quote: ... 5 μg/mL insulin and 10 ng/mL epidermal growth factor (Lonza #CC-4131). Medium was refreshed every other day ...
-
bioRxiv - Cancer Biology 2022Quote: ... Red blood cells (RBCs) were lysed using the ACK Lysis buffer (Lonza, 10-548E). Dead cell removal kit (Miltenyi Biotec ...
-
bioRxiv - Genomics 2022Quote: ... samples were resuspended in an ammonium-chloride-potassium (ACK) lysis buffer (Lonza #10-548E) for 3-5 minutes and centrifuged ...
-
bioRxiv - Cell Biology 2019Quote: ... supplemented with 10% Fetal Bovine Serum (FBS; HyClone) and 50 µg/ml Gentamicin (Lonza). Medium was replaced every two to three days ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... supplemented with 10% (v/v) heat-inactivated Foetal Bovine Serum (FBS) (Lonza Group Ltd.) containing 100 µg streptomycin ml−1 and 100 U penicillin ml−1 using neomycin (400 µg/ml ...
-
bioRxiv - Cell Biology 2020Quote: ... the cells were removed from the substrates with 10 x Trypsin (Lonza, BE02-007E) and a second set of images were obtained of the microspheres in a cell-free configuration ...
-
bioRxiv - Immunology 2020Quote: ... Cells were suspended in medium with 10% fetal calf serum (BioWhittaker, Lonza, Basel, Switzerland), supplemented with 20 ng/ml rGM-CSF (PeproTech ...
-
bioRxiv - Genomics 2021Quote: ... Frozen aliquots of 10 million human PBMCs from healthy individuals were purchased from Lonza, requiring healthy donors only ...
-
bioRxiv - Developmental Biology 2022Quote: ... in 45 % LCDM 45% FBS and 10% DMSO orProFreeze Freezing medium (Lonza, 12-769E) at 2×10^6 cells per ml.
-
bioRxiv - Cell Biology 2023Quote: ... 5 μg/mL insulin and 10 ng/mL epidermal growth factor (Lonza #CC-4131). Medium was refreshed every other day until near confluency before treatment commencement ...
-
bioRxiv - Immunology 2022Quote: ... 1% penicillin-streptomycin and 1% Ultra-glutamine (both from Lonza) RPMI 1640 media ...
-
bioRxiv - Neuroscience 2019Quote: ... 1% NEAA (Lonza), 1% N2 supplement (Thermo Scientific) ...
-
bioRxiv - Cancer Biology 2020Quote: ... 1% Ultraglutamine (Lonza)) in each well ...
-
bioRxiv - Genetics 2022Quote: ... 1% glutamine (Lonza) and 1% penicillin-streptomycin (Sigma) ...
-
bioRxiv - Molecular Biology 2021Quote: ... and Alt-R™ HDR donor oligo 5’ GTGTTTAGAAAAAAAAGAGTGTTTTTTTACCAGGGCCTTTGGCTCTTCCAGGAAGCAGATGTCCGAGTCGGAATATAATAACCCTTTCATACTCTTG 3’ (PS modification, antisense; IDT) using a 4D-nucleofector System X Unit (Lonza, Basel, Switzerland) and the P3 primary Cell 4D-Nucleofector® X kit (#V4XP-3024 ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: Five milligrams of niclosamide inhalation powder was loaded into size #3 hydroxypropyl methylcellulose capsules (Vcaps® plus, Capsugel®, Lonza, Morristown, NJ, USA). The aerodynamic properties of the powder were evaluated using a Next Generation Impactor (NGI ...
-
bioRxiv - Neuroscience 2022Quote: ... Harvested EBs were transferred to a tissue-culture treated 6-well plate (Falcon, #353224) in 3 ml of EB Differentiation media: X-VIVO 15 (Lonza Biosciences, #04-418Q) + 1% Glutamax (Life Technologies ...
-
bioRxiv - Cancer Biology 2024Quote: ... 1×106 T cells were transfected with Cas9/RNPs complexes of CD38 targeting guide RNA 5’-AGUGUAUGGGAUGCUUUCAA -3’ (Synthego) using Lonza 4D-Nucleofector™ X Unit (Lonza, AAF-1003X). Transfection was carried out in P3 Primary Cell 4D-Nucleofector™ Solution (Lonza ...
-
bioRxiv - Molecular Biology 2019Quote: ... ES cells were grown in 1:1 mixture of DMEM (Lonza BioWhittaker Cat ...
-
bioRxiv - Cell Biology 2021Quote: ... neutralized 1:1 with Trypsin Neutralising Solution (TNS, Lonza, #CC-5002), spun down and concentrated to 15*106 cells/mL in EGM-2 ...