Labshake search
Citations for Lonza :
351 - 400 of 1259 citations for 8 chloro 10 3 dimethylamino propyl phenothiazin 1 ol since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2019Quote: The transfection of the HBMEC cells was carried out according to the same protocol but with 3 μg DNA for 0.5×106 cells in 100 μl cells of Cell Line Nucleofector Solution V (Lonza) with the program U-015 ...
-
bioRxiv - Cell Biology 2022Quote: Human umbilical vein endothelial cells (HUVEC) were cultured between passage 3 and 6 in EGM-2 complete medium (Lonza)3,52–55 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Regular testing for mycoplasma contamination was conducted every 3-4 weeks using the MycoAlert PLUS mycoplasma detection kit (Lonza).
-
bioRxiv - Cell Biology 2022Quote: Normal human bronchial epithelial cells (HBECs) from 3 independent donors (Supplemental Table S1) were obtained from Lonza (CC-2540) and cultured in BEGM growth media (Lonza CC-3170) ...
-
bioRxiv - Biophysics 2023Quote: ... DNA samples were also analyzed by electrophoresis through 1.5 % and 3 % agarose gels (Seakem LE agarose, Lonza, Rockland, ME) in TAE (Tris-acetate + 1 mM EDTA ...
-
bioRxiv - Genetics 2023Quote: ... An equivalent of 2.5×105 CD34+ HSPCs were mixed with gRNA:Cas9 complexes and 3 µg ssDNA donor template (20 μL) in nucleofector strip format (Lonza). Electroporation was performed in Unit X ...
-
Self-organised pattern formation in the developing neural tube by a temporal relay of BMP signallingbioRxiv - Developmental Biology 2023Quote: A total of 3-4µg of plasmid DNA was electroporated into 3-4x106 early passage ES cells using the Amaxa Nucleofector II (Lonza) programme A-023 ...
-
bioRxiv - Bioengineering 2024Quote: ... and SK-BR-3 cells (Korean Cell Line Bank, Korea) were cultured in Dulbecco’s modified Eagle’s medium (DMEM; Lonza, Switzerland) supplemented with 10 % (v/v ...
-
bioRxiv - Cancer Biology 2024Quote: ... and (iv) the NDF-2 and NDF-3 cell lines (human neonatal dermal fibroblast cell lines, #CC-2509; Lonza Bioscience ...
-
bioRxiv - Cancer Biology 2023Quote: ... 1% of penicillin-streptomycin and 1% of Ultraglutamine-1 (Lonza, Basel, Switzerland). U-2 OS cells were grown in high-glucose DMEM (Sigma-Aldrich ...
-
bioRxiv - Physiology 2022Quote: ... in F12 : DMEM (1 : 1) (Lonza, UK). Following digestion the suspension was passed through sterile gauze and a 70 µm cell strainer before centrifugation at 350 g for 10 minutes ...
-
bioRxiv - Cell Biology 2020Quote: ... supplemented with 15% FBS (Mef Abl-/-) or 10% FBS (for MCF7) (Lonza) and 100 U/ml penicillin/streptomycin (Lonza ...
-
bioRxiv - Microbiology 2022Quote: ... 10-fold dilutions were prepared in EMEM 1X ((EMEM Lonza, #12-684F), 0,12% NaHCO3 (Sigma ...
-
bioRxiv - Immunology 2021Quote: ... supplemented with 10% Foetal Calf Serum (FCS) (PAA,, AT or Lonza, CH), 100U/mL penicillin (Sigma-Alrdich ...
-
bioRxiv - Microbiology 2021Quote: ... high glucose supplemented with 10% fetal bovine serum (FBS) (Lonza, Basel, Switzerland), penicillin (100 U/mL) ...
-
bioRxiv - Immunology 2021Quote: ... samples were placed in a sterile-filtered medium containing 10%FBS (Lonza), IMDM (Lonza) ...
-
bioRxiv - Developmental Biology 2020Quote: ... amphotericin B (50 ng/ml) epidermal growth factor (10 ng/ml) (Lonza) and 10% Fetal Bovine serum (FBS ...
-
bioRxiv - Genomics 2020Quote: ... The CD34+ cells were thawed and put into X-VIVO 10 (Lonza) containing 1% Glutamax (Gibco) ...
-
bioRxiv - Genomics 2020Quote: ... an aliquot of cells was cultured in X-VIVO 10 media (Lonza) containing 1% Glutamax (Gibco) ...
-
bioRxiv - Genetics 2022Quote: ... supplemented with 10% fetal bovine serum (FBS) and MycoZapTM Plus-CL (Lonza). Cells were transfected with pJC_GAA100 plasmid by using JetPRIME® (Polyplus-transfection ...
-
bioRxiv - Microbiology 2022Quote: ... All media were supplemented with 10% heat inactivated foetal bovine serum (Lonza) and 100 U/ml penicillin/streptomycin (Gibco) ...
-
bioRxiv - Immunology 2023Quote: ... containing 10% v/v deactivated fetal bovine serum (dFBS, Lonza, Basel, Switzerland), 100 µg/mL streptomycin (Invitrogen ...
-
bioRxiv - Bioengineering 2023Quote: ... diluted from 10× stock solution (17-517Q, Lonza Pharma & Biotech, Maryland, USA).
-
bioRxiv - Cell Biology 2023Quote: ... supplemented with 10% (v/v) heat-inactivated foetal calf serum (FBS, Lonza), 2mM L-glutamine (Lonza) ...
-
bioRxiv - Developmental Biology 2023Quote: ... the cells were washed with 10 mL ice-cold 1x PBS (Lonza) twice ...
-
bioRxiv - Cell Biology 2023Quote: ... were cultured in high-glucose DMEM containing 10% FBS (12-614F, Lonza), 10 U/ml Penicillin ...
-
bioRxiv - Cancer Biology 2023Quote: ... supplemented with 10% (v/v) heat-inactivated foetal bovine serum (FBS) (Lonza) and 1% of 100 IU penicillin and 100 µg/ml streptomycin (ThermoFisher Scientific ...
-
bioRxiv - Immunology 2023Quote: ... 2×106 or 10×106 cells were resuspended with P3 buffer (Lonza) and mixed with 60 or 300 pmol TRAC RNP in a total volume of 20 or 100 μl ...
-
bioRxiv - Immunology 2023Quote: ... activated CTLs suspended in phenol red-free X-vivo-10 media (Lonza) supplemented with 10% FBS were incubated with the PA gel substrates and imaged using Nikon spinning disc confocal microscope equipped with EMCCD ...
-
bioRxiv - Microbiology 2020Quote: ... Infected CD4 T cells were washed with PBS and 3 million cells per condition were resuspended in 20uL buffer P2 (Lonza) with 4μM IDT electroporation enhancer ...
-
bioRxiv - Immunology 2022Quote: ... Thawed PBMCS were rested for 3-4h at 37°C in X-VIVO 15 Serum-free Hematopoietic Cell Medium (Lonza) supplemented with 5% human Ab serum ...
-
bioRxiv - Genetics 2020Quote: ... ∼1×106 cells were transfected with pairs of 5 µg gRNA plasmid and 4 µg ssODN (Supplementary Table 3) using AmaxaTM Human CD34 Cell NucleofectorTM Kit (Lonza) in the 2B-NucleofectorTM on the U-08 setting ...
-
bioRxiv - Neuroscience 2020Quote: ... The spinal cord was spun at 3000 rpm for 3 min at room temperature after which the embryonic medium was replaced with 1x trypsin-EDTA (Lonza). The tissue was macerated in trypsin and incubated at 37°C for 15-20 mins ...
-
bioRxiv - Microbiology 2021Quote: ... Viral supernatants were collected 3 and 6 days post-infection and induced-cell death and viral titers were determined in the ToxiLight Bioassay (Lonza) and PFA ...
-
bioRxiv - Molecular Biology 2020Quote: ... at Day 3-4 of phase I culture were electroporated using P3 Primary Cell 4D NucleofectorTM X Kit (from Lonza) with program DZ100 (Bak et al. ...
-
PSGL-1 inhibits HIV-1 infection by restricting actin dynamics and sequestering HIV envelope proteinsbioRxiv - Microbiology 2020Quote: ... 1×106 activated CD4+T cells were stimulated by IFN-γ for 24 h before being transfected with 3 siRNAs following Amaxa Nucleofector following the manufacturer’s protocols (Lonza). Two days post transfection ...
-
bioRxiv - Cell Biology 2022Quote: ... All cell lines were tested to be negative for mycoplasma every 2–3 months using the MycoAlert Mycoplasma Detection Kit (Lonza).
-
bioRxiv - Cell Biology 2022Quote: ... and diseased COPD human lung fibroblasts (DHLFs) from 3 donors (donor IDs: OF3353, OF3418 and OF3238) were purchased from Lonza and tested for their response to FGF2 and TGFβ stimulation.
-
bioRxiv - Cancer Biology 2022Quote: ... and then combined with 3 µL of RNP mixture and nucleofected using program DJ-110 (melanoma) or EH100 (TILs) on a 4D Nucleofector (Lonza). Melanoma cells were immediately recovered in full melanoma media in 12-well plates ...
-
bioRxiv - Genetics 2020Quote: ... hESCs were nucleofected with 2 μg of CRISPR and 3 μl ssODN (100 μm) using the P3 Primary Cell Kit L (Lonza). hESCs were then plated onto puromycin-resistant (DR4 ...
-
bioRxiv - Immunology 2021Quote: ... 2.106 T cells were resuspended in 20 µl of nucleofection solution with 3 µl or 4 µl RNP and transferred to Nucleofection cuvette strips (4D-Nucleofector X kit S; Lonza). Murine T cells were electroporated using the DN110 program of 4D nucleofector (4D-Nucleofector Core Unit ...
-
bioRxiv - Immunology 2019Quote: ... A20 and A20 D1.3 B cells (3 × 106cells) were transiently transfected using the AMAXA nucleofector kit V (Lonza, #VCA-1003) or the Ingenio electroporation kit (Mirus ...
-
bioRxiv - Cell Biology 2021Quote: ... were isolated from healthy donors (n=3) as described[4] and seeded on 6 cm dishes within BEGM media (Lonza) before transduction with lentivirus (empty vector (Origene ...
-
bioRxiv - Microbiology 2021Quote: ... The human lung epithelial cell line Calu-3 (ATCC HTB-55) was maintained in DMEM F-12 (Lonza, Basel, Switzerland) supplemented with 10% FBS ...
-
bioRxiv - Developmental Biology 2023Quote: ... 5.0-8.0 × 105 BTAG cells were electroporated with 3 μg of each gRNA using Amaxa 4D nucleofector (Lonza, V4XP-3012) and the CA-137 program ...
-
bioRxiv - Developmental Biology 2023Quote: iPSCs were transfected with sgRNA 3’ UCCCUUUCCUCAGGUCACAG 5’ (Synthego) via nucleofection using program CA137 on a 4D Nucleofactor X (Lonza) as per manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... The PCR products were then loaded and migrated by electrophoresis on a 3% Tris-borate-EDTA (TBE) agarose gel supplemented with GelStar Nucleic Acid Gel Stain (Lonza) for approximately one hour ...
-
bioRxiv - Immunology 2024Quote: ... They were then transfected by nucleofection with 3 μg of plasmid DNA in 100 μl of Cell Line Nucleofector Solution V (Lonza) using the V-001 program (Amaxa Biosystems) ...
-
bioRxiv - Developmental Biology 2020Quote: ... a 1:1 mix containing EGM2-Incomplete (Lonza) and macrophage media (v/v ...
-
bioRxiv - Cell Biology 2021Quote: ... Human primary hepatic stellate cells from donors 3 and 4 were purchased as isolated hepatic stellate cells from Lonza (cat# HUCLS). Donor information is listed below.