Labshake search
Citations for Lonza :
401 - 450 of 1957 citations for 4 Methoxy 2 2 3 4 5 5 Hexacb Unlabeled 50 Ug Ml In Nonane since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2022Quote: ... The hCMEC/D3 cells were cultured in EBM-2 medium supplemented with EGM-2 MV SingleQuots (Lonza) on plates coated with rat tail collagen I (20 µg/cm2 ...
-
bioRxiv - Bioengineering 2021Quote: ... in EGM-2 MV Microvascular Endothelial Cell Growth Medium containing EBM-2 basal medium (Lonza cat. CC3156) and supplemented with penicillin (50 units/mL ...
-
bioRxiv - Cancer Biology 2019Quote: ... Human umbilical vein endothelial cells (HUVEC) were grown in endothelial cells growth medium-2 (EGM-2) (Lonza). All cells were cultured at 37◻°C and 5% CO2 in incubator cells.
-
bioRxiv - Synthetic Biology 2022Quote: ... and EGM™ −2 MV Microvascular Endothelial Cell Growth Medium-2 Bullet KitTM (Cat #CC-3202; Lonza) in collagen coated culture dishes (Cat # 08-772-75 ...
-
bioRxiv - Immunology 2022Quote: ... 24 and 48 well-plates in EGM™-2 Endothelial Cell Growth Medium-2 BulletKit™ (LONZA) supplemented with GlutaMax (ThermoFisher ...
-
An endothelial SOX18-mevalonate pathway axis enables repurposing of statins for infantile hemangiomabioRxiv - Molecular Biology 2024Quote: ... MilliporeSigma) plates with a density of 20,000 cells/cm2 with Endothelial Growth Medium-2 (EGM-2; Lonza), which consists of Endothelial Growth Basal Medium-2 (EBM-2 ...
-
bioRxiv - Molecular Biology 2024Quote: ... Cells were cultured in EGM™-2 Endothelial Cell Growth Medium-2 BulletKit™ (Lonza, CC-3162) and plated in T75 culture flask at 5000 cells/ cm2 with iMatrix-511 (Nacalai USA #892021).
-
bioRxiv - Biochemistry 2024Quote: ... Cells were split at a 1:2 ratio every 2 days by trypsinization (Lonza cat# CC-5012), followed by centrifugation at 200 x g for 3 min before resuspending and reseeding in EBM Basal Medium supplemented with the EGM Singlequots Supplement Pack ...
-
bioRxiv - Cell Biology 2024Quote: ... were cultured on fibronectin-coated plates in EBM-2 Basal Medium with EGM-2 MV supplements (Lonza) and 10 ug/mL VEGF-C (RnD Systems) ...
-
bioRxiv - Developmental Biology 2020Quote: ... completed with 5% fetal bovine serum (FBS, Lonza) and 2mM L-glutamine (Sigma-Aldrich) ...
-
bioRxiv - Molecular Biology 2021Quote: ... and Alt-R™ HDR donor oligo 5’ GTGTTTAGAAAAAAAAGAGTGTTTTTTTACCAGGGCCTTTGGCTCTTCCAGGAAGCAGATGTCCGAGTCGGAATATAATAACCCTTTCATACTCTTG 3’ (PS modification, antisense; IDT) using a 4D-nucleofector System X Unit (Lonza, Basel, Switzerland) and the P3 primary Cell 4D-Nucleofector® X kit (#V4XP-3024 ...
-
bioRxiv - Cancer Biology 2024Quote: ... 1×106 T cells were transfected with Cas9/RNPs complexes of CD38 targeting guide RNA 5’-AGUGUAUGGGAUGCUUUCAA -3’ (Synthego) using Lonza 4D-Nucleofector™ X Unit (Lonza, AAF-1003X). Transfection was carried out in P3 Primary Cell 4D-Nucleofector™ Solution (Lonza ...
-
bioRxiv - Synthetic Biology 2021Quote: ... Isolated NK cells were activated at 1 x 106 cells mL-1 for 5 days in XVivo15 medium (Lonza) with 5% fetal bovine serum ...
-
bioRxiv - Microbiology 2021Quote: ... was adjusted to OD600 of 2.5 (2.2 × 109 bacteria/mL) and the bacteria were then further diluted in serum-free XVIVO-15 medium (Lonza) prior to infection to obtain the respective multiplicity of infection (MOI) ...
-
Multiplexed single-cell transcriptomic analysis of normal and impaired lung development in the mousebioRxiv - Cell Biology 2019Quote: ... The cell suspension was than centrifuged and the resulting pellet was resuspended in 5 ml DPBS (Lonza, Basel, Switzerland), thoroughly filtered through 40 μm filter (Corning Life Sciences ...
-
bioRxiv - Microbiology 2022Quote: ... and the well was gently washed once with 5 mL of phosphate buffered saline (PBS, Lonza, Rockland, ME, USA) to remove un-adherent floating bacteria ...
-
bioRxiv - Zoology 2021Quote: ... 50 μg/mL streptomycin (all from Lonza, Belgium) and with 10% of decomplemented fetal calf serum (Gibco ...
-
bioRxiv - Immunology 2020Quote: ... streptomycin (50 μg/ml; Cambrex-Lonza, Basel, Switzerland), and sodium bicarbonate (3.024 g/l ...
-
bioRxiv - Cell Biology 2023Quote: ... streptomycin (50 μg/ml) and MycoZap (Lonza, Switzerland). All cells are cultured at 37 °C in a humidified atmosphere with 5% CO2.
-
bioRxiv - Developmental Biology 2020Quote: ... amphotericin B (50 ng/ml) epidermal growth factor (10 ng/ml) (Lonza) and 10% Fetal Bovine serum (FBS ...
-
bioRxiv - Immunology 2020Quote: ... followed by washing in complete media (RPMI-1640 containing 10% FBS, 2 mM glutamine, 100 IU/ml penicillin, and 100 µg/ml streptomycin, Lonza, Walkersville, MD, USA). Isolated BAL cells (approx.1-2 x106 ...
-
bioRxiv - Bioengineering 2022Quote: ... for 1.5 h at 37°C and 5% CO2 before seeded with human umbilical vein endothelial cells (HUVECs, pooled donor, Lonza, Switzerland). Endothelial Cell Growth Medium-2 (EGM-2 ...
-
bioRxiv - Biochemistry 2023Quote: ... Cells were regularly passaged 2-3 times a week and routinely tested for mycoplasma contamination using MycoAlert Plus mycoplasma Detection kit (Lonza, #LT07-710).
-
bioRxiv - Immunology 2022Quote: ... 2×106 B cells were then nucleofected with 2 μg of plasmid DNA using Nucleofector Kit V (Lonza) and rested for at least 16-24 hours using complete media containing 5 ng/ml BAFF and lacking LPS ...
-
bioRxiv - Cancer Biology 2019Quote: ... were grown as tissue culture monolayers (2-D) in EGM™-2 medium supplemented with MV BulletKit (Lonza). For tube-formation assays ...
-
bioRxiv - Developmental Biology 2022Quote: Primary human umbilical vein endothelial cells (HUVECs, passage 2) were thawed and cultured in EGM-2 media (Lonza). Media was replaced every 48h ...
-
bioRxiv - Biochemistry 2020Quote: ... supplemented with 6.6 % FCS and 33 % EBM™-2 Endothelial Cell Growth Basal Medium-2 (Lonza, Basel, Switzerland). HELA cells (DSMZ ACC-57 ...
-
bioRxiv - Neuroscience 2020Quote: ... HUVECs were cultured in endothelial basal medium (EBM-2) supplemented with endothelial growth factors EGM-2 SingleQuots (Lonza).
-
bioRxiv - Neuroscience 2021Quote: ... coated coverslips in a 24-well plate in 1ml Endothelial Growth Media-2 Bullet Kit (EGM-2; Lonza; Endothelial basal media-2 with 2% Fetal Bovine Serum (FBS) ...
-
bioRxiv - Neuroscience 2022Quote: ... were cultured in EGM-2 endothelial cell growth medium-2 from the BulletKit (Lonza, Basel, Switzerland; CC-3162). Pericytes and astrocytes were used for experiments up to passage 4 ...
-
bioRxiv - Neuroscience 2022Quote: ... Human umbilical vein endothelial cells (HUVECs) were cultured in EBM-2 medium supplemented with EGM-2 SingleQuots (Lonza) on plates coated with rat tail collagen I (20 µg/cm2 ...
-
bioRxiv - Bioengineering 2019Quote: ... HUVECs P6 were cultured on flask in EGM™-2 Endothelial Cell Growth Medium-2 BulletKit ™ (Lonza). Cells were detached and loaded in PLA devices with seeding density 1 ×106 cells/ml ...
-
bioRxiv - Developmental Biology 2021Quote: ... 2×106 iPSC single cells were transfected using the Amaxa Human Stem Cell Nucleofector® Kit 2 (Lonza) with 4 μg ...
-
bioRxiv - Cell Biology 2022Quote: ... cat# 540-05a) were cultured in flasks coated with 2% gelatin using endothelial basal medium 2 (EBM2, Lonza) supplemented with bullet kit additives plus 10% fetal bovine serum ...
-
bioRxiv - Cell Biology 2022Quote: ... BUB-1 and CLS-2::GFP production was performed in 2 L SF9 cells in Insect-XPRESS (Lonza) medium (1×10^6 cells/mL) ...
-
bioRxiv - Molecular Biology 2022Quote: ... HUVECs were prepared in 6-well plates with 2.8.105 cells/well in EGM-2 medium (Endothelial Cell Growth Medium-2, Lonza). Cells were transduced in duplicate with 20 MOI (Multiplicity of Infection ...
-
bioRxiv - Bioengineering 2023Quote: ... Cells were cultured in EGM™-2 Endothelial Cell Growth Medium-2 BulletKit (Lonza cat. no. CC-3162) in sterile conditions within a 5% CO2 and 37°C incubator ...
-
bioRxiv - Molecular Biology 2023Quote: ... The culture medium used was EGMTM-2 MV Microvascular Endothelial Cell Growth Medium-2 BulletKitTM (Lonza, Basel, Switzerland). The cells were cultured for 24 h and total RNA was collected as described in the RT-PCR protocol.
-
bioRxiv - Molecular Biology 2024Quote: ... were added to ABCs and EGM™-2 Endothelial Cell Growth Medium-2 BulletKit™ (Lonza, CC-3162) with iMatrix was added to HUVECs and then incubated in 37°C at 5% O2 ...
-
bioRxiv - Cell Biology 2020Quote: Electroporation was performed using an Amaxa 4-D device (Lonza) or a Neon Transfection System (Thermo Fisher) ...
-
bioRxiv - Molecular Biology 2020Quote: ... 4 days after nucleofection with the AMAXA Nucleofector Kit (Lonza), we applied puromycin selection until we observed the appearance of green colonies ...
-
bioRxiv - Developmental Biology 2020Quote: ... embedded in 4% low melting temperature agarose (Lonza, Cat # 50100) and sectioned in a vibratome to produce 300μm-thick coronal slices ...
-
bioRxiv - Microbiology 2019Quote: ... a solution of 4% (wt/vol) SeaPlaque GTG agarose (Lonza) in MilliQ water was sterilized for 30 minutes at 250°C ...
-
bioRxiv - Bioengineering 2023Quote: ... Normal human dermal fibroblasts (NHDFs; Lonza; passages 4 to 10) were cultured on dishes in Dulbecco’s Modified Eagle’s Medium (DMEM ...
-
bioRxiv - Neuroscience 2024Quote: ... and mounted in 4% low melting point agarose (50100, Lonza) for sectioning (70 μm ...
-
bioRxiv - Bioengineering 2019Quote: ... or γδ-T cells were activated and cultured for 2 days at 0.5 to 1.0 million cells/mL in XVivo15 medium (Lonza) with 5% Fetal Bovine Serum ...
-
bioRxiv - Molecular Biology 2021Quote: ... at a density of 2 million cells/mL in serum-free cell culture medium (Lonza AG, Basel, Switzerland) supplemented with 0.5 μg/mL FMS-like tyrosine kinase-3 (Peprotech ...
-
bioRxiv - Cancer Biology 2021Quote: ... supplemented with 2 mM Ultraglutamine I (Lonza), 10 mM HEPES (GIBCO) ...
-
bioRxiv - Molecular Biology 2022Quote: ... were cultured in EGM-2 medium (Lonza) at 37 °C in a 5% CO2 incubator ...
-
bioRxiv - Genomics 2020Quote: ... run on a 2% NuSieve agarose (Lonza) gel ...